G560069



Basic Information


Item Value
gene id G560069
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 92396119 ~ 92396955 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU635375
tccaggtctggtgtttattacagtatttgatccaggtctggtgtttattgcagtatttgatccaggtctggtgtttactacagtatttgatccaggtctggtgtttattacagtatttgatccaggtctggtgtttactacagtatttgatccaggtctggtgtttattacagtatttgatccaggtctggtgtttattacagtatttgatccaggtctggtgtttattccagtatttgatccaggtctggtgtttattccagtatttgatccaggtctggtgtttattccagtatttgatccaggtctgg

Function


NR:

description
PREDICTED: keratin-associated protein 16-1-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU635375 True 311 lncRNA 0.40 2 92396119 92396955

Neighbor


gene id symbol gene type direction distance location
LOC118964976 NA coding upstream 298494 92092621 ~ 92097625 (+)
LOC118965057 LOC106596248 coding upstream 327891 92067440 ~ 92068228 (+)
LOC110526817 tipin coding upstream 329554 92048098 ~ 92066565 (+)
lctla LOC105026505 coding upstream 351304 92031197 ~ 92044815 (+)
LOC118964972 NA coding upstream 422731 91970091 ~ 91973388 (+)
LOC118964978 NA coding downstream 28115 92370253 ~ 92431717 (+)
trnaq-cug-2 NA coding downstream 41120 92438075 ~ 92438146 (+)
LOC110487142 LOC106587922 coding downstream 43194 92440149 ~ 92597197 (+)
LOC118965058 NA coding downstream 47264 92444219 ~ 92462980 (+)
LOC110527020 LOC106587930 coding downstream 363053 92760008 ~ 92767862 (+)
G560058 NA non-coding upstream 43374 92349562 ~ 92352745 (+)
G560045 NA non-coding upstream 84097 92309773 ~ 92312022 (+)
G560036 NA non-coding upstream 95604 92299880 ~ 92300515 (+)
G560032 NA non-coding upstream 108622 92286925 ~ 92287497 (+)
G560018 NA non-coding upstream 150397 92245254 ~ 92245722 (+)
G560042 NA non-coding downstream 19282 92416237 ~ 92417238 (+)
G560233 NA non-coding downstream 44779 92441734 ~ 92443222 (+)
G560237 NA non-coding downstream 51583 92448538 ~ 92449045 (+)
G560241 NA non-coding downstream 81888 92478843 ~ 92479489 (+)
G560246 NA non-coding downstream 94907 92491862 ~ 92492932 (+)
G560039 NA other upstream 91482 92303528 ~ 92304637 (+)
LOC110517107 LOC106587912 other upstream 615502 91764066 ~ 91789867 (+)
LOC110511547 pde8a other upstream 787024 91490509 ~ 91699286 (+)
G560229 LOC106562795 other downstream 291244 92685849 ~ 92690662 (+)
G560701 NA other downstream 815810 93212765 ~ 93217580 (+)
G560794 LOC106587968 other downstream 929281 93326236 ~ 93328882 (+)
LOC110516628 LOC106587980 other downstream 1139270 93536089 ~ 93568621 (+)

Expression


G560069 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G560069 Expression in each Bioproject

Bar chart with 5 bars.
G560069 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network