G560334



Basic Information


Item Value
gene id G560334
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 92504464 ~ 92504703 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU635829
AACAGCTGATATCTGAGGTACTATAGTGTTAAACAGCTGATATCTGAGGATCTATAGTGTTAAACAGTTGATATCTGAGGTACTATAGTGTTAAACAGCTGATATCTGAGGTACTATATAGTGTCAAACAGCTGATATCTGAGGTACTATATAGTGTTAAACAGCTGATATCTGAGGTACTATAGTGTTAAACAGCTGATATCTGAGGT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU635829 True 209 lncRNA 0.35 2 92504464 92504703
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110517548 LOC106588008 coding downstream 66579 92431448 ~ 92437885 (-)
LOC110526820 LOC106591161 coding downstream 383977 92072533 ~ 92120487 (-)
LOC118964975 NA coding downstream 429314 92073802 ~ 92075150 (-)
LOC110526819 NA coding downstream 431960 92071246 ~ 92072504 (-)
LOC110525055 LOC106562861 coding downstream 476109 92017222 ~ 92028355 (-)
LOC118964979 LOC106587942 coding upstream 95062 92599765 ~ 92656885 (-)
LOC118964980 NA coding upstream 159254 92663957 ~ 92664768 (-)
LOC118964981 LOC105026498 coding upstream 160425 92665128 ~ 92680265 (-)
LOC110507000 LOC106587953 coding upstream 182420 92687123 ~ 92710683 (-)
LOC110527023 LOC106587927 coding upstream 291905 92795995 ~ 92800681 (-)
G560320 NA non-coding downstream 33176 92469438 ~ 92471288 (-)
G560311 NA non-coding downstream 53627 92449653 ~ 92450837 (-)
G560227 NA non-coding downstream 65068 92439195 ~ 92439396 (-)
G560216 NA non-coding downstream 73698 92423284 ~ 92430766 (-)
G560220 NA non-coding downstream 86486 92417389 ~ 92417978 (-)
G560350 NA non-coding upstream 36152 92540855 ~ 92549254 (-)
G560358 NA non-coding upstream 67222 92571925 ~ 92572364 (-)
G560363 NA non-coding upstream 75194 92579897 ~ 92581291 (-)
G560367 NA non-coding upstream 82339 92587042 ~ 92587934 (-)
G560370 NA non-coding upstream 90769 92595472 ~ 92599371 (-)
G560090 dis3l other downstream 428734 92071282 ~ 92075730 (-)
G560087 LOC106596248 other downstream 435947 92067405 ~ 92068517 (-)
G559894 NA other downstream 518654 91985280 ~ 91985810 (-)
LOC110500502 LOC106562864 other downstream 677108 91804173 ~ 91969990 (-)
G560709 NA other upstream 592470 93097173 ~ 93099232 (-)
G560725 NA other upstream 615668 93120371 ~ 93122351 (-)
G560973 NA other upstream 818596 93322585 ~ 93325175 (-)
cdhr5a LOC106587968 other upstream 842994 93325891 ~ 93362506 (-)

Expression


G560334 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G560334 Expression in each Bioproject

Bar chart with 6 bars.
G560334 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network