G561896



Basic Information


Item Value
gene id G561896
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 94679099 ~ 94680387 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU638126
acatggtctacacatactgagacagagagatgctgtttcactgtccagacagcatcagatacatggtctacacatactgagacagagagatgctgtttcactgtccagacagcatcagatacatggtctacacatactgagacagagaggatgctgtttcactgtccagacagcatcagatacatggtctacacatactgagacagagaggtgctgtttcactgtccagacagcatcagatacatggtctacacatactgagac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU638126 True 264 lncRNA 0.45 3 94679099 94680387
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110527030 LOC106609696 coding downstream 60806 94579252 ~ 94618293 (-)
LOC118964993 NA coding downstream 105675 94570785 ~ 94573424 (-)
LOC110525058 herc1 coding downstream 112262 94324853 ~ 94566837 (-)
LOC118964990 LOC105029587 coding downstream 815987 93844809 ~ 94253848 (-)
LOC110518911 LOC106562776 coding downstream 853388 93820258 ~ 93825711 (-)
LOC110500983 trpm1 coding upstream 88770 94769157 ~ 94854085 (-)
LOC118964995 NA coding upstream 156051 94836438 ~ 94839842 (-)
LOC118964997 NA coding upstream 313300 94993687 ~ 94994963 (-)
LOC110517419 LOC106591491 coding upstream 318268 94997378 ~ 95172633 (-)
LOC110526865 gtf2a2 coding upstream 500147 95180534 ~ 95182874 (-)
G561865 NA non-coding downstream 14771 94663849 ~ 94664328 (-)
G561886 NA non-coding downstream 24937 94653843 ~ 94654162 (-)
LOC110499808 LOC106609698 non-coding downstream 26467 94651207 ~ 94695854 (-)
G561883 NA non-coding downstream 32749 94646092 ~ 94646350 (-)
G561881 NA non-coding downstream 33590 94645288 ~ 94645509 (-)
G561904 NA non-coding upstream 18990 94699377 ~ 94699614 (-)
G561908 NA non-coding upstream 19561 94699948 ~ 94701082 (-)
G561907 idh3a non-coding upstream 28516 94708903 ~ 94710229 (-)
G561905 idh3a non-coding upstream 32291 94712678 ~ 94714486 (-)
G561918 NA non-coding upstream 39206 94719593 ~ 94720032 (-)
G561791 NA other downstream 341890 94336552 ~ 94343200 (-)
G561786 NA other downstream 373665 94303980 ~ 94305434 (-)
G561730 NA other downstream 530940 94145590 ~ 94148159 (-)
G561086 NA other downstream 1017127 93642901 ~ 93661972 (-)
G561917 NA other upstream 37761 94718148 ~ 94719474 (-)
G561923 NA other upstream 52444 94732831 ~ 94733169 (-)
G561939 NA other upstream 161672 94842059 ~ 94843245 (-)
G562068 NA other upstream 620323 95300710 ~ 95301575 (-)

Expression


G561896 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G561896 Expression in each Bioproject

Bar chart with 15 bars.
G561896 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.

Co-expression Network