G561918



Basic Information


Item Value
gene id G561918
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 94719593 ~ 94720032 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU638155
gtttctattcaacagagtctcagagctccatgttgttgttgtttctattctattcaacagagtctcagagctccatgttgttgttgtttctattcaacagagtctcaaagctccatgttgttgtttctattcaacagagtctcagagctccatgttgttgtttctattcaacagagtctcagagctccatgttgttgtttctattcaacagagtctcagagctccatgttgttgtttctattcaacagagtctcagagctccatgttgttgtttctattcaacagagtctcaaagctccatgttgttgtttctattctattcaacagagtctcaacgctccatgttgttgtttatattcaacagagtc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU638155 True 368 lncRNA 0.39 2 94719593 94720032

Neighbor


gene id symbol gene type direction distance location
LOC110499808 LOC106609698 coding downstream 23739 94651207 ~ 94695854 (-)
LOC110527030 LOC106609696 coding downstream 101300 94579252 ~ 94618293 (-)
LOC118964993 NA coding downstream 146169 94570785 ~ 94573424 (-)
LOC110525058 herc1 coding downstream 152756 94324853 ~ 94566837 (-)
LOC118964990 LOC105029587 coding downstream 856481 93844809 ~ 94253848 (-)
LOC110500983 trpm1 coding upstream 49125 94769157 ~ 94854085 (-)
LOC118964995 NA coding upstream 116406 94836438 ~ 94839842 (-)
LOC118964997 NA coding upstream 273655 94993687 ~ 94994963 (-)
LOC110517419 LOC106591491 coding upstream 278623 94997378 ~ 95172633 (-)
LOC110526865 gtf2a2 coding upstream 460502 95180534 ~ 95182874 (-)
G561905 idh3a non-coding downstream 5107 94712678 ~ 94714486 (-)
G561907 idh3a non-coding downstream 9364 94708903 ~ 94710229 (-)
G561908 NA non-coding downstream 18511 94699948 ~ 94701082 (-)
G561904 NA non-coding downstream 19979 94699377 ~ 94699614 (-)
G561896 NA non-coding downstream 39206 94679099 ~ 94680387 (-)
G561920 NA non-coding upstream 8172 94728204 ~ 94729954 (-)
G561921 NA non-coding upstream 9223 94729255 ~ 94730526 (-)
G561928 NA non-coding upstream 20135 94740167 ~ 94741633 (-)
G561930 NA non-coding upstream 33677 94753709 ~ 94753990 (-)
G561931 NA non-coding upstream 35915 94755947 ~ 94760632 (-)
G561917 NA other downstream 119 94718148 ~ 94719474 (-)
G561791 NA other downstream 382384 94336552 ~ 94343200 (-)
G561786 NA other downstream 414159 94303980 ~ 94305434 (-)
G561923 NA other upstream 12799 94732831 ~ 94733169 (-)
G561939 NA other upstream 122027 94842059 ~ 94843245 (-)
G562068 NA other upstream 580678 95300710 ~ 95301575 (-)
LOC110526882 LOC106588117 other upstream 837375 95523601 ~ 95598393 (-)

Expression


G561918 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G561918 Expression in each Bioproject

Bar chart with 10 bars.
G561918 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network