G562511



Basic Information


Item Value
gene id G562511
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 95793930 ~ 95794213 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU639091
accactaacaacacatatgcctggaatcctacatcaccactaacaacacatatgtctggaatcctacatcaccactaacaacacatatgcctggaatccttcatcaccactaacaacacatatgcctggaatccttcatcaccactaacaacacatatgcctggaatcctacatcactactaacaacacatatgtctggaatcctacatcacctacatcaccactaacaacacatatgcctggaatcctacatcacctacatcaccactaacaacacatatgcc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU639091 True 284 lncRNA 0.42 1 95793930 95794213
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118964998 LOC105028853 coding downstream 79542 95666386 ~ 95714388 (-)
LOC118936667 LOC106588121 coding downstream 143939 95623080 ~ 95649991 (-)
LOC110526883 LOC106588066 coding downstream 176450 95612224 ~ 95617480 (-)
LOC110526882 LOC106588117 coding downstream 195537 95523601 ~ 95598393 (-)
LOC110526865 gtf2a2 coding downstream 611056 95180534 ~ 95182874 (-)
LOC110510392 LOC106594384 coding upstream 11507 95805720 ~ 95815422 (-)
LOC110513793 LOC106592435 coding upstream 44623 95838836 ~ 95872040 (-)
LOC118965001 NA coding upstream 185689 95979902 ~ 95980788 (-)
cep89 LOC106591800 coding upstream 186592 95980805 ~ 96153978 (-)
LOC110518217 NA coding upstream 370432 96164645 ~ 96168334 (-)
G562510 NA non-coding downstream 9198 95784457 ~ 95784732 (-)
G562496 NA non-coding downstream 52926 95740660 ~ 95741004 (-)
G562482 NA non-coding downstream 109792 95683831 ~ 95684138 (-)
G562481 NA non-coding downstream 110162 95683301 ~ 95683768 (-)
G562456 NA non-coding downstream 134223 95658818 ~ 95659707 (-)
G562512 NA non-coding upstream 4529 95798742 ~ 95799494 (-)
G562513 NA non-coding upstream 6222 95800435 ~ 95800713 (-)
G562514 NA non-coding upstream 7308 95801521 ~ 95801803 (-)
G562515 NA non-coding upstream 8144 95802357 ~ 95802697 (-)
G562452 NA non-coding upstream 21415 95815628 ~ 95820614 (-)
G562068 NA other downstream 492355 95300710 ~ 95301575 (-)
LOC110517419 LOC106591491 other downstream 756082 94997378 ~ 95172633 (-)
G561939 NA other downstream 950685 94842059 ~ 94843245 (-)
G562544 NA other upstream 105861 95900074 ~ 95902190 (-)
G562598 NA other upstream 221656 96015869 ~ 96016126 (-)
rhpn2 rhpn2 other upstream 374297 96168510 ~ 96248849 (-)
G563041 LOC106597055 other upstream 501040 96295253 ~ 96295874 (-)
G563076 NA other upstream 602744 96396957 ~ 96397772 (-)

Expression


G562511 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G562511 Expression in each Bioproject

Bar chart with 8 bars.
G562511 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network