G562598



Basic Information


Item Value
gene id G562598
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 96015869 ~ 96016126 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU639201
agacgatgcaatctcaaccacactgcacaccgccctaacccatctggacaagaggaatacctatgtgagaatgctgttcattgactacagctcggcattcaacaccatagtaccctccaagctcgtcatcaagctcgagaccctgggtctcgaccccaccctgtgcaactgggtactggacttcctgacgggccgcccccaggtggtgagggtaggcaacaacatctcctccccgctgatcctcaacactggggcccc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU639201 True 258 TUCP 0.57 1 96015869 96016126

Neighbor


gene id symbol gene type direction distance location
LOC118965001 NA coding downstream 35081 95979902 ~ 95980788 (-)
LOC110513793 LOC106592435 coding downstream 143829 95838836 ~ 95872040 (-)
LOC110510392 LOC106594384 coding downstream 200447 95805720 ~ 95815422 (-)
LOC118964998 LOC105028853 coding downstream 301481 95666386 ~ 95714388 (-)
LOC118936667 LOC106588121 coding downstream 365878 95623080 ~ 95649991 (-)
LOC110518217 NA coding upstream 148519 96164645 ~ 96168334 (-)
rhpn2 rhpn2 coding upstream 153353 96168510 ~ 96248849 (-)
LOC118936668 LOC106588045 coding upstream 402390 96418516 ~ 96497895 (-)
trnat-agu NA coding upstream 485110 96501236 ~ 96501309 (-)
trnat-agu-2 NA coding upstream 486161 96502287 ~ 96502360 (-)
G562597 NA non-coding downstream 853 96014742 ~ 96015016 (-)
G562596 NA non-coding downstream 1541 96013510 ~ 96014328 (-)
G562589 NA non-coding downstream 20577 95994625 ~ 95995292 (-)
G562588 NA non-coding downstream 21385 95993154 ~ 95994484 (-)
G562600 NA non-coding upstream 6035 96022161 ~ 96022647 (-)
G562601 NA non-coding upstream 9940 96026066 ~ 96026337 (-)
G562607 NA non-coding upstream 40093 96056219 ~ 96092226 (-)
G562609 NA non-coding upstream 41384 96057510 ~ 96060190 (-)
G562613 NA non-coding upstream 44717 96060843 ~ 96067402 (-)
G562544 NA other downstream 113679 95900074 ~ 95902190 (-)
LOC110526882 LOC106588117 other downstream 432534 95523601 ~ 95598393 (-)
G562068 NA other downstream 714294 95300710 ~ 95301575 (-)
LOC110517419 LOC106591491 other downstream 978021 94997378 ~ 95172633 (-)
G563041 LOC106597055 other upstream 279127 96295253 ~ 96295874 (-)
G563076 NA other upstream 380831 96396957 ~ 96397772 (-)
G563078 NA other upstream 383369 96399495 ~ 96399910 (-)
G563054 NA other upstream 396593 96412719 ~ 96415283 (-)

Expression


G562598 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G562598 Expression in each Bioproject

Bar chart with 19 bars.
G562598 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network