G562684



Basic Information


Item Value
gene id G562684
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 96272308 ~ 96272996 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU639315
accacaaccactacagctaccacaacccctacagctaccacaaccactacagctaccacaaccactacagctaccacaaccactacagttaccacaaccaccacaacccctacagctaccacaaccaccacaaccactacagctaccacaaccaccacaaccaccacaacccctacagctaccacaaccacccatacagctaccacaaccaccacaacccctacagctaccacaaccaccacaaccaccacaaccactacagctaccacaaccaccacaacccctacagctaccacaaccaccacaaccaccacaaccactacagctaccacaaccaccacaaccactacagctaccacaaccactacagctaccacaaccac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU639315 True 383 lncRNA 0.53 2 96272308 96272996
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118965000 LOC106593614 coding upstream 259408 95996318 ~ 96012900 (+)
LOC110510618 bat1 coding upstream 301811 95900120 ~ 95970508 (+)
LOC118965061 NA coding upstream 372225 95899021 ~ 95900083 (+)
LOC110512655 LOC106562400 coding upstream 506144 95723489 ~ 95768149 (+)
LOC110526881 LOC106588123 coding upstream 650117 95617490 ~ 95622191 (+)
LOC110514610 LOC106591035 coding downstream 50233 96323229 ~ 96392558 (+)
LOC110507008 LOC106588037 coding downstream 724017 96997013 ~ 97014268 (+)
LOC118965002 NA coding downstream 1077509 97350492 ~ 97353435 (+)
LOC110516620 LOC106562854 coding downstream 1096715 97369711 ~ 97529904 (+)
LOC110513174 LOC106588022 coding downstream 1263538 97536534 ~ 97670291 (+)
G562654 NA non-coding upstream 71601 96200267 ~ 96200707 (+)
G562641 rhpn2 non-coding upstream 102383 96168506 ~ 96169925 (+)
G562642 NA non-coding upstream 104043 96165754 ~ 96168265 (+)
G562640 NA non-coding upstream 106845 96164655 ~ 96165463 (+)
G562639 NA non-coding upstream 112262 96159037 ~ 96160046 (+)
G562692 NA non-coding downstream 19859 96292855 ~ 96293287 (+)
G562693 LOC106597055 non-coding downstream 22351 96295347 ~ 96295812 (+)
G562697 NA non-coding downstream 40715 96313711 ~ 96313964 (+)
G562698 NA non-coding downstream 41118 96314114 ~ 96314353 (+)
G562707 NA non-coding downstream 53857 96326853 ~ 96327127 (+)
G562296 NA other upstream 497582 95772739 ~ 95774726 (+)
G562256 NA other upstream 603001 95666330 ~ 95669307 (+)
G562248 NA other upstream 625418 95646134 ~ 95646890 (+)
G562719 NA other downstream 111740 96384736 ~ 96387940 (+)
G562740 NA other downstream 208838 96481834 ~ 96487225 (+)
LOC118936669 NA other downstream 1469156 97679917 ~ 97796621 (+)
G563588 NA other downstream 1649635 97922631 ~ 97923034 (+)

Expression


G562684 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G562684 Expression in each Bioproject

Bar chart with 8 bars.
G562684 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network