G563078



Basic Information


Item Value
gene id G563078
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 96399495 ~ 96399910 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU639951
ccactgatgatagtagagataccactgatgatagtagagataccactgatgatagtagagatacctaccactgatgatagtagaggtaccactgatgatagtagagataccactgatgatagtagaggtaccactgatgatagtagaggtaccactgatgatagtagagataccactgatgatagtagaggtaccactgatgatagtagagataccactgatgatagtagagataccactgatgatagtagagatacctaccactgatgatagtagaggtaccactgatgatagtagaggtacgtaccactgatgatagtagagataccactgatgatagtagagatacctaccactgatgatagtagaggtaccactgatgatagtagagataccactgatgatagtagagatac

Function


NR:

description
PREDICTED: uncharacterized protein LOC106593258

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU639951 True 416 TUCP 0.40 1 96399495 96399910

Neighbor


gene id symbol gene type direction distance location
rhpn2 rhpn2 coding downstream 150646 96168510 ~ 96248849 (-)
LOC110518217 NA coding downstream 231161 96164645 ~ 96168334 (-)
cep89 LOC106591800 coding downstream 245517 95980805 ~ 96153978 (-)
LOC118965001 NA coding downstream 418707 95979902 ~ 95980788 (-)
LOC110513793 LOC106592435 coding downstream 527455 95838836 ~ 95872040 (-)
LOC118936668 LOC106588045 coding upstream 18606 96418516 ~ 96497895 (-)
trnat-agu NA coding upstream 101326 96501236 ~ 96501309 (-)
trnat-agu-2 NA coding upstream 102377 96502287 ~ 96502360 (-)
LOC118965063 wdr88 coding upstream 109186 96509096 ~ 96523590 (-)
LOC110512044 LOC106562075 coding upstream 132844 96532754 ~ 96547975 (-)
G563071 NA non-coding downstream 3176 96394843 ~ 96396319 (-)
G563070 NA non-coding downstream 4900 96393291 ~ 96394595 (-)
G563072 LOC106591036 non-coding downstream 6606 96389318 ~ 96392889 (-)
G563075 NA non-coding downstream 11538 96385177 ~ 96387957 (-)
G563069 NA non-coding downstream 16608 96382229 ~ 96382887 (-)
G563079 NA non-coding upstream 101 96400011 ~ 96400498 (-)
G563055 NA non-coding upstream 11283 96411193 ~ 96411638 (-)
G563054 NA non-coding upstream 12809 96412719 ~ 96415283 (-)
G563091 NA non-coding upstream 60413 96460323 ~ 96460903 (-)
G563076 NA other downstream 1723 96396957 ~ 96397772 (-)
G563041 LOC106597055 other downstream 103621 96295253 ~ 96295874 (-)
G562598 NA other downstream 383369 96015869 ~ 96016126 (-)
G562544 NA other downstream 497305 95900074 ~ 95902190 (-)
LOC110510636 LOC106591093 other upstream 175031 96550200 ~ 96610542 (-)
G563273 NA other upstream 562854 96962764 ~ 96963398 (-)
G563391 NA other upstream 908553 97308463 ~ 97309226 (-)
G563824 NA other upstream 1345013 97744923 ~ 97745503 (-)

Expression


G563078 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G563078 Expression in each Bioproject

Bar chart with 12 bars.
G563078 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network