G562740


Basic Information

Item Value
gene id G562740
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 96481834 ~ 96487225 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU639398
ccccattagttcctgtcaaggcagcagctacttttcctggggtttattatggatccccattagttcctgtcaaggcagcagctactcttcctggggtttattatggatccccattagttcctgccaaggcagcagctactcttcctggggtttattatggatccccattagttcctgttcaacatgttcaataccaccacatatctacaacacaacatgttcaataccaccacatatctacaacatgttcaataccaccacatatctacaacatgttcaataccaccacatatctacaacatgttcaataccaccccatatctacaacatgttcaataccaccccatatctacaacatgttcaataccaccacatatctacaacatgttcaataccaccacatatctacaacacaacatgttcaataccaccacatatctacaacatgttcaataccaccacatatctacaacacaacatgttcaataccaccacatatctacaacacaacatgttcaataccaccacatatctacaacacaacatgttcaataccaccacatatctacaacacgttcaataccaccacatatctacaacacaacatgttcaataccaccacatatctacaacacgttcaataccaccacatatctacaacat

Function

NR:

description
PREDICTED: putative proline-rich protein 21

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU639398 True 663 TUCP 0.40 2 96481834 96487225
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110514610 LOC106591035 coding upstream 89936 96323229 ~ 96392558 (+)
LOC118965000 LOC106593614 coding upstream 468934 95996318 ~ 96012900 (+)
LOC110510618 bat1 coding upstream 511337 95900120 ~ 95970508 (+)
LOC118965061 NA coding upstream 581751 95899021 ~ 95900083 (+)
LOC110512655 LOC106562400 coding upstream 715670 95723489 ~ 95768149 (+)
LOC110507008 LOC106588037 coding downstream 509788 96997013 ~ 97014268 (+)
LOC118965002 NA coding downstream 863280 97350492 ~ 97353435 (+)
LOC110516620 LOC106562854 coding downstream 882486 97369711 ~ 97529904 (+)
LOC110513174 LOC106588022 coding downstream 1049309 97536534 ~ 97670291 (+)
LOC118936669 NA coding downstream 1192692 97679917 ~ 97796621 (+)
G562732 NA non-coding upstream 10995 96467391 ~ 96470839 (+)
G562706 NA non-coding upstream 64363 96414380 ~ 96417471 (+)
G562721 NA non-coding upstream 69838 96411789 ~ 96411996 (+)
G562720 NA non-coding upstream 76294 96405205 ~ 96405540 (+)
G562701 NA non-coding upstream 85503 96394843 ~ 96396331 (+)
G562742 NA non-coding downstream 5403 96492628 ~ 96493953 (+)
G562746 NA non-coding downstream 14664 96501889 ~ 96502092 (+)
G562748 NA non-coding downstream 20264 96507489 ~ 96509735 (+)
G562751 NA non-coding downstream 39217 96526442 ~ 96527300 (+)
G562755 NA non-coding downstream 54405 96541630 ~ 96607890 (+)
G562719 NA other upstream 93894 96384736 ~ 96387940 (+)
G562296 NA other upstream 707108 95772739 ~ 95774726 (+)
G562256 NA other upstream 812527 95666330 ~ 95669307 (+)
G563588 NA other downstream 1435406 97922631 ~ 97923034 (+)
G563596 NA other downstream 1462848 97950073 ~ 97951916 (+)
G564164 NA other downstream 1993355 98480580 ~ 98483302 (+)

Expression

G562740 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G562740 Expression in each Bioproject

Bar chart with 15 bars.
G562740 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network