G562746



Basic Information


Item Value
gene id G562746
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 96501889 ~ 96502092 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU639407
TGTGGGAAGATATAAGGGAGTCTGACTATTGGGAAATGAATGTTGAAGAAAAGTACACTGAATTTAGACTACCAAACGGCTATTTAGGCCCAATCACCACCTATTCAGAGTAAGTTACTATAGATAGTTCAGTTTGAAACATTCTCTATGAAATGGGCTTTTACATTATGTGTAATTAATTGTATGTAGTTACCTATTGGTGTA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU639407 True 204 lncRNA 0.34 1 96501889 96502092
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110514610 LOC106591035 coding upstream 109991 96323229 ~ 96392558 (+)
LOC118965000 LOC106593614 coding upstream 488989 95996318 ~ 96012900 (+)
LOC110510618 bat1 coding upstream 531392 95900120 ~ 95970508 (+)
LOC118965061 NA coding upstream 601806 95899021 ~ 95900083 (+)
LOC110512655 LOC106562400 coding upstream 735725 95723489 ~ 95768149 (+)
LOC110507008 LOC106588037 coding downstream 494921 96997013 ~ 97014268 (+)
LOC118965002 NA coding downstream 848413 97350492 ~ 97353435 (+)
LOC110516620 LOC106562854 coding downstream 867619 97369711 ~ 97529904 (+)
LOC110513174 LOC106588022 coding downstream 1034442 97536534 ~ 97670291 (+)
LOC118936669 NA coding downstream 1177825 97679917 ~ 97796621 (+)
G562742 NA non-coding upstream 7936 96492628 ~ 96493953 (+)
G562732 NA non-coding upstream 31050 96467391 ~ 96470839 (+)
G562706 NA non-coding upstream 84418 96414380 ~ 96417471 (+)
G562721 NA non-coding upstream 89893 96411789 ~ 96411996 (+)
G562720 NA non-coding upstream 96349 96405205 ~ 96405540 (+)
G562748 NA non-coding downstream 5397 96507489 ~ 96509735 (+)
G562751 NA non-coding downstream 24350 96526442 ~ 96527300 (+)
G562755 NA non-coding downstream 39538 96541630 ~ 96607890 (+)
G562761 LOC106591634 non-coding downstream 52357 96554449 ~ 96554994 (+)
G562766 NA non-coding downstream 66178 96568270 ~ 96569058 (+)
G562740 NA other upstream 14664 96481834 ~ 96487225 (+)
G562719 NA other upstream 113949 96384736 ~ 96387940 (+)
G562296 NA other upstream 727163 95772739 ~ 95774726 (+)
G563588 NA other downstream 1420539 97922631 ~ 97923034 (+)
G563596 NA other downstream 1447981 97950073 ~ 97951916 (+)
G564164 NA other downstream 1978488 98480580 ~ 98483302 (+)

Expression


G562746 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G562746 Expression in each Bioproject

Bar chart with 1 bar.
G562746 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network