G562751



Basic Information


Item Value
gene id G562751
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 96526442 ~ 96527300 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU639415
CTGTACTACAGAGCATGTGTTATAATGAGAGTCCTGTGTTTAGTGCTATCACGAGGACACAGCGATATTTGATCCTGTATTTTAAGAGGACAGTTTGAAGGTTCAAACCCAGGCGTATCAGATGACTGTGTAAAACACAAGGTGTCCTAGATCTGACATACAGTCTGTCTCTAGCTACTGGGTCTACATTTCATGATGCCAAGTTAGAGTGTTACAACAGTCTGTCTCTAGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU639415 True 232 lncRNA 0.42 2 96526442 96527300

Neighbor


gene id symbol gene type direction distance location
LOC110514610 LOC106591035 coding upstream 134544 96323229 ~ 96392558 (+)
LOC118965000 LOC106593614 coding upstream 513542 95996318 ~ 96012900 (+)
LOC110510618 bat1 coding upstream 555945 95900120 ~ 95970508 (+)
LOC118965061 NA coding upstream 626359 95899021 ~ 95900083 (+)
LOC110512655 LOC106562400 coding upstream 760278 95723489 ~ 95768149 (+)
LOC110507008 LOC106588037 coding downstream 469713 96997013 ~ 97014268 (+)
LOC118965002 NA coding downstream 823205 97350492 ~ 97353435 (+)
LOC110516620 LOC106562854 coding downstream 842411 97369711 ~ 97529904 (+)
LOC110513174 LOC106588022 coding downstream 1009234 97536534 ~ 97670291 (+)
LOC118936669 NA coding downstream 1152617 97679917 ~ 97796621 (+)
G562748 NA non-coding upstream 16707 96507489 ~ 96509735 (+)
G562746 NA non-coding upstream 24350 96501889 ~ 96502092 (+)
G562742 NA non-coding upstream 32489 96492628 ~ 96493953 (+)
G562732 NA non-coding upstream 55603 96467391 ~ 96470839 (+)
G562706 NA non-coding upstream 108971 96414380 ~ 96417471 (+)
G562755 NA non-coding downstream 14330 96541630 ~ 96607890 (+)
G562761 LOC106591634 non-coding downstream 27149 96554449 ~ 96554994 (+)
G562766 NA non-coding downstream 40970 96568270 ~ 96569058 (+)
G562770 NA non-coding downstream 52279 96579579 ~ 96582224 (+)
G562776 NA non-coding downstream 72702 96600002 ~ 96600712 (+)
G562740 NA other upstream 39217 96481834 ~ 96487225 (+)
G562719 NA other upstream 138502 96384736 ~ 96387940 (+)
G562296 NA other upstream 751716 95772739 ~ 95774726 (+)
G563588 NA other downstream 1395331 97922631 ~ 97923034 (+)
G563596 NA other downstream 1422773 97950073 ~ 97951916 (+)
G564164 NA other downstream 1953280 98480580 ~ 98483302 (+)

Expression


G562751 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G562751 Expression in each Bioproject

Bar chart with 2 bars.
G562751 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 35.
End of interactive chart.

Co-expression Network