G563240



Basic Information


Item Value
gene id G563240
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 96901443 ~ 96901757 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU640170
TAGTGTAATAGTTACCTGGCAGGGCTGTGTTAACTCTGTCTAGTGTAGTAGTTACCTGGCAGGGCTGTGTTATCTCTGTCTAGTGTAATAGTTACCTGGCAGGGCTGTGTTATCTCTGTCTAGTGTAGTAGTTACCTGGCAGGGCTGTGTTATCTCTGTCTAGTGTAATAGTTACCTGGCAGGGCTGTGTTATCTCTGTCTAGTGTAGTAGTTACCTGGCAGGGCTGTGTTATCTCTGTCTAGTGTAGTAGTTACCTGGCAGGGCTGTGTTATCTCTGTCTAGTGTAGTAGTTACCTGGCAGGGCTGTGTTATCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU640170 True 315 lncRNA 0.46 1 96901443 96901757
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118965091 NA coding downstream 234912 96666140 ~ 96666531 (-)
LOC110510636 LOC106591093 coding downstream 290901 96550200 ~ 96610542 (-)
LOC110512044 LOC106562075 coding downstream 353468 96532754 ~ 96547975 (-)
LOC118965063 wdr88 coding downstream 377853 96509096 ~ 96523590 (-)
trnat-agu-2 NA coding downstream 399083 96502287 ~ 96502360 (-)
LOC100379111 LOC100379111 coding upstream 79012 96980769 ~ 96982194 (-)
LOC110507011 LOC106588039 coding upstream 91372 96993129 ~ 96997805 (-)
LOC110511555 abcc12 coding upstream 323242 97224999 ~ 97347752 (-)
tppp3 LOC106588035 coding upstream 1187817 98089574 ~ 98130946 (-)
LOC118965005 zdhhc1 coding upstream 1253010 98154767 ~ 98210096 (-)
G563235 NA non-coding downstream 5487 96895276 ~ 96895956 (-)
G563191 NA non-coding downstream 42727 96767636 ~ 96858716 (-)
G563221 NA non-coding downstream 52395 96848754 ~ 96849048 (-)
G563209 NA non-coding downstream 74557 96824000 ~ 96826886 (-)
G563208 NA non-coding downstream 78425 96821991 ~ 96823018 (-)
G563242 NA non-coding upstream 3732 96905489 ~ 96905764 (-)
G563246 NA non-coding upstream 8535 96910292 ~ 96910586 (-)
G563252 NA non-coding upstream 20449 96922206 ~ 96923070 (-)
G563257 NA non-coding upstream 34589 96936346 ~ 96938602 (-)
G563259 NA non-coding upstream 39323 96941080 ~ 96941754 (-)
G563054 NA other downstream 486160 96412719 ~ 96415283 (-)
G563078 NA other downstream 501533 96399495 ~ 96399910 (-)
G563076 NA other downstream 503671 96396957 ~ 96397772 (-)
G563041 LOC106597055 other downstream 605569 96295253 ~ 96295874 (-)
G563273 NA other upstream 61007 96962764 ~ 96963398 (-)
G563391 NA other upstream 406706 97308463 ~ 97309226 (-)
G563824 NA other upstream 843166 97744923 ~ 97745503 (-)

Expression


G563240 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G563240 Expression in each Bioproject

Bar chart with 9 bars.
G563240 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network