G563549



Basic Information


Item Value
gene id G563549
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 97815206 ~ 97815620 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU640712
GTTTTATACTGTTTTCTCTGATTCCAGGTCAGTCTTTACCACCCAGCAGAGCAACTAGTCAGGGTTTATACTGTTTTCTCTGATTCCAGGTCAGTCTTTGTTATTAATACTGTCTAGATCAGTGTTAGTTATGTTGACAGGTCGGTAATAGATAACAACAGTTTCCAGATCAGTGTTAGTTATGTTGACAGGTCGGTAATAGATAACAACAGTATCCAGATCAGTGTTAGTTATGTTGACAGGTCGGTAATAGATAACAACAGTATCCAGATCAGTGTAAACGTGGCACACAGAACACCAGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU640712 True 302 lncRNA 0.39 3 97815206 97815620
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118936669 NA coding upstream 18585 97679917 ~ 97796621 (+)
LOC110513174 LOC106588022 coding upstream 144915 97536534 ~ 97670291 (+)
LOC110516620 LOC106562854 coding upstream 285302 97369711 ~ 97529904 (+)
LOC118965002 NA coding upstream 462346 97350492 ~ 97353435 (+)
LOC110507008 LOC106588037 coding upstream 800938 96997013 ~ 97014268 (+)
LOC118965004 NA coding downstream 128636 97944256 ~ 97947528 (+)
LOC118965006 NA coding downstream 388751 98204371 ~ 98206233 (+)
hsd11b2 LOC100135822 coding downstream 620937 98436557 ~ 98488276 (+)
LOC118965093 agrp1 coding downstream 755086 98570706 ~ 98575061 (+)
LOC118965094 NA coding downstream 783627 98599247 ~ 98600304 (+)
G563546 NA non-coding upstream 10377 97803759 ~ 97804829 (+)
G563544 NA non-coding upstream 13927 97799775 ~ 97801279 (+)
G563538 NA non-coding upstream 31349 97783087 ~ 97783857 (+)
G563531 NA non-coding upstream 51974 97762963 ~ 97763232 (+)
G563530 NA non-coding upstream 52503 97760823 ~ 97762703 (+)
G563550 NA non-coding downstream 5965 97821585 ~ 97821831 (+)
G563566 NA non-coding downstream 49998 97865618 ~ 97866473 (+)
G563570 NA non-coding downstream 59509 97875129 ~ 97876119 (+)
G563569 NA non-coding downstream 59977 97875597 ~ 97876194 (+)
G563576 NA non-coding downstream 76983 97892603 ~ 97895388 (+)
G562740 NA other upstream 1327981 96481834 ~ 96487225 (+)
G562719 NA other upstream 1427266 96384736 ~ 96387940 (+)
LOC118965000 LOC106593614 other upstream 1802958 95996318 ~ 96012900 (+)
G563588 NA other downstream 107011 97922631 ~ 97923034 (+)
G563596 NA other downstream 134453 97950073 ~ 97951916 (+)
G564164 NA other downstream 664960 98480580 ~ 98483302 (+)
LOC110526849 vps13c other downstream 984890 98789830 ~ 99009256 (+)
G564500 NA other downstream 1252287 99067907 ~ 99068597 (+)

Expression


G563549 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G563549 Expression in each Bioproject

Bar chart with 12 bars.
G563549 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network