G564492



Basic Information


Item Value
gene id G564492
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 99015733 ~ 99017159 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU642114
GTTCAAAACAGACCAATCAAAAAGCCAGTACTAGGTGAGGAACAGCAGAATGGAGCAGACTACTGAAACACATTATACTAGGTGAGGAACAGCAGAATGGAGTAGACTACTGAAACACATTATACTAGGTGAGGAACAGCAGAATGGAGTAGACTACTGAAACACATTATACTAGGTAAGGAACAGCAGAATGGAGCAGACTACTGAAACACA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU642114 True 213 lncRNA 0.41 3 99015733 99017159
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110526852 NA coding upstream 2070 99012670 ~ 99013663 (+)
LOC110526849 vps13c coding upstream 6477 98789830 ~ 99009256 (+)
LOC118965008 NA coding upstream 196966 98816363 ~ 98818767 (+)
LOC110525057 LOC106592677 coding upstream 227435 98786714 ~ 98788594 (+)
LOC110516022 LOC105025469 coding upstream 291353 98680420 ~ 98724380 (+)
LOC118965009 NA coding downstream 82163 99099322 ~ 99102231 (+)
LOC110526853 LOC105021099 coding downstream 224408 99241567 ~ 99314530 (+)
LOC110514875 anx2a coding downstream 323588 99340747 ~ 99357939 (+)
p24b p24b coding downstream 389294 99406453 ~ 99412263 (+)
LOC110498619 LOC105016647 coding downstream 407527 99424686 ~ 99469650 (+)
G564488 NA non-coding upstream 10415 99004746 ~ 99005318 (+)
G564484 NA non-coding upstream 22513 98992986 ~ 98993220 (+)
G564483 NA non-coding upstream 22978 98992552 ~ 98992755 (+)
G564496 NA non-coding downstream 4278 99021437 ~ 99021731 (+)
G564505 NA non-coding downstream 59095 99076254 ~ 99080252 (+)
G564516 NA non-coding downstream 84079 99101238 ~ 99102038 (+)
G564517 NA non-coding downstream 87469 99104628 ~ 99107725 (+)
G564527 NA non-coding downstream 124718 99141877 ~ 99142510 (+)
G564164 NA other upstream 532431 98480580 ~ 98483302 (+)
G563596 NA other upstream 1063817 97950073 ~ 97951916 (+)
G563588 NA other upstream 1092699 97922631 ~ 97923034 (+)
LOC118936669 NA other upstream 1220107 97679917 ~ 97796621 (+)
G564500 NA other downstream 50748 99067907 ~ 99068597 (+)
G564667 NA other downstream 519861 99537020 ~ 99539242 (+)
LOC110513770 LOC106588105 other downstream 628310 99616756 ~ 99663639 (+)
G564805 NA other downstream 791680 99808839 ~ 99809932 (+)

Expression


G564492 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G564492 Expression in each Bioproject

Bar chart with 16 bars.
G564492 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network