XLOC_024821 (hist1h4l)


Basic Information

Item Value
gene id XLOC_024821
gene name hist1h4l
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007136.7
NCBI id CM002909.2
chromosome length 37502051
location 35045803 ~ 35046114 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00048887
ATGTCTGGAAGAGGCAAAGGCGGTAAAGGACTTGGAAAAGGAGGTGCTAAGCGTCACCGTAAAGTTCTGCGTGATAACATCCAGGGAATCACCAAACCCGCTATCCGTCGTCTCGCTCGCCGTGGTGGAGTCAAACGTATCTCTGGTCTGATCTATGAGGAGACTCGTGGTGTTCTTAAGGTCTTTCTGGAGAATGTTATCCGTGATGCTGTTACGTACACCGAGCACGCCAAGAGAAAGACCGTGACCGCCATGGATGTTGTGTACGCGCTGAAGAGACAGGGACGTACTCTGTACGGTTTCGGAGGTTAA

Function

symbol description
hist1h4l Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to act upstream of or within DNA-templated transcription, initiation. Predicted to be located in chromosome and nucleus. Predicted to be part of nucleosome. Is expressed in head.

GO:

id name namespace
GO:0006352 DNA-templated transcription, initiation biological_process
GO:0000786 nucleosome cellular_component
GO:0005634 nucleus cellular_component
GO:0005694 chromosome cellular_component
GO:0003677 DNA binding molecular_function
GO:0046982 protein heterodimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070927-10 Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to act upstream of or within DNA-templated transcription, initiation. Predicted to be located in chromosome and nucleus. Predicted to be part of nucleosome. Is expressed in head.

Ensembl:

ensembl_id ENSDARG00000111753

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00048887 True 312 mRNA 0.51 1 35045803 35046114

Neighbor

gene id symbol gene type direction distance location
XLOC_024820 zgc:114046 coding downstream 553 35044524 ~ 35045250 (-)
XLOC_024819 NA coding downstream 3693 35002155 ~ 35042110 (-)
XLOC_024818 NA coding downstream 66245 34975083 ~ 34979558 (-)
XLOC_024817 cdk10 coding downstream 72592 34956368 ~ 34973211 (-)
XLOC_024816 NA coding downstream 107672 34933831 ~ 34938131 (-)
XLOC_024822 si:dkey-108k21.19 coding upstream 1340 35047454 ~ 35047838 (-)
XLOC_024823 NA coding upstream 5942 35052056 ~ 35116923 (-)
XLOC_024824 kif15 coding upstream 22052 35068166 ~ 35095129 (-)
XLOC_024825 zgc:162611 coding upstream 51048 35097162 ~ 35101673 (-)
XLOC_024826 NA coding upstream 56011 35102125 ~ 35139520 (-)
XLOC_024813 NA non-coding downstream 321827 34672068 ~ 34723976 (-)
XLOC_024811 NA non-coding downstream 402599 34641440 ~ 34643204 (-)
XLOC_024851 NA non-coding upstream 225164 35271278 ~ 35276350 (-)
XLOC_024853 NA non-coding upstream 266762 35312876 ~ 35313623 (-)
XLOC_024859 NA non-coding upstream 688937 35735051 ~ 35735523 (-)

Expression


Co-expression Network