trnaf-gaa-79



Basic Information


Item Value
gene id trnaf-gaa-79
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 60627229 ~ 60627301 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnaf-gaa-79
gccgaaatagctcagttgggagagcgttagactgaagatctaaatgtccctggttcgatcccgggtttcggca

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnaf-gaa-79 True 73 mRNA 0.52 1 60627229 60627301
Loading

Neighbor


gene id symbol gene type direction distance location
LOC100136654 ip6k2 coding downstream 63817 60553435 ~ 60563412 (-)
LOC110528150 LOC106583199 coding downstream 96551 60512572 ~ 60530678 (-)
uroc1 uroc1 coding downstream 126786 60490775 ~ 60500443 (-)
LOC110528145 LOC105017320 coding downstream 139288 60478688 ~ 60487941 (-)
si:dkey-197j19.6 LOC106583152 coding downstream 155761 60458510 ~ 60471468 (-)
LOC110528152 LOC106583196 coding upstream 12564 60639865 ~ 60669084 (-)
LOC110528989 LOC106583145 coding upstream 71978 60699279 ~ 60822525 (-)
LOC110528153 LOC106583194 coding upstream 303000 60930301 ~ 60933747 (-)
LOC110528154 gnai2 coding upstream 318763 60946064 ~ 61041619 (-)
LOC110528155 LOC106583192 coding upstream 428088 61055389 ~ 61128517 (-)
G630902 NA non-coding downstream 51753 60488050 ~ 60575476 (-)
G630886 NA non-coding downstream 256777 60370161 ~ 60370452 (-)
G630788 NA non-coding downstream 387902 60176578 ~ 60239327 (-)
G630794 NA non-coding downstream 435392 60191327 ~ 60191837 (-)
G631214 NA non-coding upstream 202085 60829386 ~ 60829648 (-)
G631238 NA non-coding upstream 219699 60847000 ~ 60847202 (-)
G631253 NA non-coding upstream 228130 60855431 ~ 60855779 (-)
G631321 NA non-coding upstream 258498 60885799 ~ 60888175 (-)
G630747 NA other downstream 543372 60083046 ~ 60083857 (-)
G630227 NA other downstream 709678 59915979 ~ 59917551 (-)
G630132 NA other downstream 874638 59747450 ~ 59752591 (-)
sfrs3 sfrs3 other downstream 1913655 58707572 ~ 58713630 (-)
LOC110528083 LOC106583085 other downstream 1931462 58691817 ~ 58695856 (-)
G631740 NA other upstream 563407 61190708 ~ 61191045 (-)
G631687 emc3 other upstream 570706 61198007 ~ 61199438 (-)
G632459 NA other upstream 1063947 61691248 ~ 61691644 (-)
G632994 LOC106583176 other upstream 1593971 62221272 ~ 62222445 (-)

Expression


trnaf-gaa-79 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network