G567750


Basic Information

Item Value
gene id G567750
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 2391350 ~ 2391919 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU646588
CAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACCAGTACTTCAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACCAGTACTTCAGTATTAACTCAGACCAGTACTTCAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACCAGTACTTCAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACCAGTACTTCAGTATTAACTCAGACTAGTACTTCAGTATTAACCCAGACTAGTAC
>TU646589
CAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACCAGTACTTCAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACCAGTACTTCAGTATTAACTCAGACCAGTACTTCAGTATTAACTCAGACCAGTACTTCAGTATTAACTCAGACTAGTACTTCAGTATTAACTCAGACCAGTACTTCAGTATTAACCC

Function

NR:

description
PREDICTED: uncharacterized protein LOC106582599

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU646588 False 358 lncRNA 0.35 2 2391350 2391919
TU646589 True 276 lncRNA 0.36 2 2391350 2391815
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110514106 nsun3 coding upstream 111336 2266347 ~ 2280014 (+)
LOC110527175 LOC106575013 coding upstream 130986 2224451 ~ 2260364 (+)
LOC110527174 LOC106575903 coding upstream 167982 2199892 ~ 2223368 (+)
LOC118965207 NA coding upstream 196624 2193508 ~ 2194726 (+)
LOC118936675 LOC106575904 coding upstream 199096 2180691 ~ 2192254 (+)
LOC110512129 LOC107691615 coding downstream 58953 2450872 ~ 2491847 (+)
LOC118965209 NA coding downstream 101148 2493067 ~ 2494996 (+)
LOC110511689 LOC105007615 coding downstream 107786 2499705 ~ 2519315 (+)
LOC110517249 LOC106575925 coding downstream 183348 2575267 ~ 2576579 (+)
LOC118965372 NA coding downstream 1801601 4193520 ~ 4194130 (+)
G567749 NA non-coding upstream 114 2390108 ~ 2391236 (+)
G567738 NA non-coding upstream 37652 2353323 ~ 2353698 (+)
G567736 NA non-coding upstream 38557 2352589 ~ 2352793 (+)
G567731 NA non-coding upstream 39825 2349991 ~ 2351525 (+)
G567728 NA non-coding upstream 47819 2343325 ~ 2343531 (+)
G567755 NA non-coding downstream 10715 2402634 ~ 2405591 (+)
G567758 NA non-coding downstream 19829 2411748 ~ 2425215 (+)
G567764 NA non-coding downstream 34107 2426026 ~ 2521439 (+)
G567769 NA non-coding downstream 48239 2440158 ~ 2443039 (+)
G567784 NA non-coding downstream 87422 2479341 ~ 2483084 (+)
G567546 NA other upstream 127668 2262287 ~ 2263682 (+)
G567566 NA other upstream 192816 2197612 ~ 2198534 (+)
G567486 NA other upstream 429803 1961133 ~ 1961547 (+)
G567400 LOC106575007 other upstream 570307 1818669 ~ 1821043 (+)
phka2 LOC106574897 other upstream 984758 1384741 ~ 1420576 (+)
G567782 NA other downstream 81731 2473650 ~ 2474223 (+)
G568255 NA other downstream 987180 3379099 ~ 3379515 (+)
G568263 NA other downstream 1006913 3398832 ~ 3406995 (+)
G568631 NA other downstream 1252330 3644249 ~ 3644958 (+)
LOC118965333 cfap47 other downstream 1923235 4278763 ~ 4318486 (+)

Expression

G567750 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G567750 Expression in each Bioproject

Bar chart with 7 bars.
G567750 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network