G569030



Basic Information


Item Value
gene id G569030
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 4368439 ~ 4368750 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU648277
CAGAGGACAGGGCCAGTCGATGTTCTAGCTGCTATATGTTCTGACCAGAGGACAGGGCCAGTCGATGTTCTAGTTGCTATATGTTCTGACCAGAGGACAGGGCCAGTCGATGTTCTAGCTGCTATATGTTCTGAACAGAGGACAGGGCCAGTCGATGTTCTAGCTGCTATATGTTCTGACCAGAGGACAGGGCCAGTCGATGTTCTAGCTGCTATATGTTCTGACCAGAGGACAGGGCCAGTCGATGTTCTAGCTGCTATATGTTCTGACCAGAGGACAGGGCCAGTCAATGTTCTAGCTGCTATATGTTCT

Function


NR:

description
uncharacterized protein LOC110534020

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU648277 True 312 lncRNA 0.50 1 4368439 4368750
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110527087 LOC106575913 coding upstream 18389 4332159 ~ 4350062 (+)
LOC118965333 cfap47 coding upstream 49953 4278763 ~ 4318486 (+)
LOC118965372 NA coding upstream 174309 4193520 ~ 4194130 (+)
LOC110517249 LOC106575925 coding upstream 1791860 2575267 ~ 2576579 (+)
LOC110511689 LOC105007615 coding upstream 1849124 2499705 ~ 2519315 (+)
LOC110511356 pcnp coding downstream 510381 4879131 ~ 4882252 (+)
LOC110518830 LOC106591572 coding downstream 554428 4923178 ~ 4950963 (+)
LOC118965217 LOC106598227 coding downstream 639340 4902577 ~ 5020268 (+)
LOC110496914 LOC106574890 coding downstream 788002 5156752 ~ 5160240 (+)
il-1ra il-1ra coding downstream 914823 5283573 ~ 5310119 (+)
G569014 NA non-coding upstream 27470 4340306 ~ 4340969 (+)
G569013 NA non-coding upstream 28618 4338952 ~ 4339821 (+)
G569003 NA non-coding upstream 38896 4327433 ~ 4329543 (+)
G569000 NA non-coding upstream 49669 4318571 ~ 4318770 (+)
LOC110519331 LOC106574979 non-coding downstream 14780 4355370 ~ 4725277 (+)
G569034 NA non-coding downstream 29496 4398246 ~ 4398785 (+)
G569035 NA non-coding downstream 32082 4400832 ~ 4402053 (+)
G569050 NA non-coding downstream 64723 4433473 ~ 4892018 (+)
G569055 NA non-coding downstream 76142 4444892 ~ 4447443 (+)
G568631 NA other upstream 723481 3644249 ~ 3644958 (+)
G568263 NA other upstream 968544 3398832 ~ 3406995 (+)
G568255 NA other upstream 988924 3379099 ~ 3379515 (+)
G567782 NA other upstream 1894216 2473650 ~ 2474223 (+)
G569207 NA other downstream 499367 4868117 ~ 4868514 (+)
G569218 LOC106591403 other downstream 525318 4894068 ~ 4896072 (+)
LOC110497014 LOC106575751 other downstream 1403211 5771961 ~ 5775857 (+)
G569923 NA other downstream 1407561 5776311 ~ 5776819 (+)
G570065 ipo5 other downstream 1653382 6022132 ~ 6024311 (+)

Expression


G569030 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G569030 Expression in each Bioproject

Bar chart with 7 bars.
G569030 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network