G570030



Basic Information


Item Value
gene id G570030
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 5915612 ~ 5916039 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU649560
TCTTCCATTTGTGCAGTAATGCTGAAATTAGGTTTGATGGACAGAGACTAGGTTTGATGGATAGAGACTAGGTTTGGTGGACAGAGACTAGGTTTGGTGGACAGAGACTAGGTTTGGTGGACAGAGACTAGGTTTGGTGGACAGAGACTAGGTTTGGTGGACAGAGACTAGGTTTGGTGGACAGAGACTAGGTTTGATGGACAGAGACTAGGTTTGGTGGATAGAGACTAGGTTTGATGGACAGAGACTAGGTTTGATGGACAGAGAC

Function


NR:

description
PREDICTED: zinc finger protein 40

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU649560 True 268 lncRNA 0.46 2 5915612 5916039
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528727 LOC106575754 coding upstream 12996 5890321 ~ 5902616 (+)
LOC110527204 LOC106574654 coding upstream 120011 5791307 ~ 5795601 (+)
LOC110527200 LOC106575752 coding upstream 124458 5786942 ~ 5791154 (+)
LOC118965221 LOC106575751 coding upstream 130886 5781376 ~ 5784726 (+)
LOC110497014 LOC106575751 coding upstream 139755 5771961 ~ 5775857 (+)
LOC110497016 LOC106575665 coding downstream 56801 5972840 ~ 5979711 (+)
LOC118965225 NA coding downstream 103121 6019160 ~ 6019827 (+)
LOC110518527 nud15 coding downstream 121793 6037832 ~ 6038818 (+)
LOC110527224 LOC105019714 coding downstream 170044 6086083 ~ 6129077 (+)
LOC110495537 LOC106574870 coding downstream 313887 6229926 ~ 6255588 (+)
G570006 NA non-coding upstream 76386 5838949 ~ 5839226 (+)
G569997 NA non-coding upstream 90938 5824397 ~ 5824674 (+)
G569970 NA non-coding upstream 176086 5650574 ~ 5739526 (+)
G569920 creg1 non-coding upstream 187175 5725329 ~ 5728437 (+)
G569909 NA non-coding upstream 370161 5544855 ~ 5545451 (+)
G570042 NA non-coding downstream 18594 5934633 ~ 5934956 (+)
G570044 NA non-coding downstream 20280 5936319 ~ 5936625 (+)
G570062 NA non-coding downstream 53217 5969256 ~ 5969608 (+)
G570070 LOC106575703 non-coding downstream 90645 6006684 ~ 6008048 (+)
G570089 NA non-coding downstream 143972 6060011 ~ 6060929 (+)
G569923 NA other upstream 138793 5776311 ~ 5776819 (+)
G569218 LOC106591403 other upstream 1019540 4894068 ~ 4896072 (+)
G569207 NA other upstream 1047098 4868117 ~ 4868514 (+)
LOC118965333 cfap47 other upstream 1599152 4278763 ~ 4318486 (+)
G570065 ipo5 other downstream 106093 6022132 ~ 6024311 (+)
G570105 NA other downstream 229046 6145085 ~ 6147543 (+)
G570118 NA other downstream 251312 6167351 ~ 6168120 (+)
G570182 NA other downstream 534171 6450210 ~ 6452314 (+)

Expression


G570030 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G570030 Expression in each Bioproject

Bar chart with 5 bars.
G570030 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network