G571538



Basic Information


Item Value
gene id G571538
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 7026700 ~ 7031863 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU651506
agagatggagagagaggaagagatatgcaggagagagagatggagagaggaagagatatgcaggagagacagatggagagggaggaagagatatgcaggagagagatggagagggaggaagagatatgcaggagagagatggagagggaggaagagatatgcaggagagacagatggagagggaggaagagatatgcaggagagagatggagagggaggaagagatatgcaggagagacagatggagagagaggaagagatatgcaggagagacagatggagagaggaagagatatgcaggagagacagatggagggaggaagagatatgcaggagagacagatggag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU651506 True 348 TUCP 0.50 3 7026700 7031863
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110495614 LOC106574963 coding downstream 100276 6919132 ~ 6926424 (-)
LOC110495621 LOC106575786 coding downstream 111474 6908878 ~ 6915226 (-)
LOC118936677 slc19a2 coding downstream 118209 6901526 ~ 6908491 (-)
LOC110497054 LOC105005823 coding downstream 136487 6864149 ~ 6890213 (-)
LOC110495631 LOC106575789 coding downstream 169412 6850467 ~ 6863766 (-)
LOC110527292 LOC106575767 coding upstream 162218 7194081 ~ 7197946 (-)
LOC118965339 cfap47 coding upstream 192354 7224217 ~ 7245229 (-)
LOC110511494 cfap47 coding upstream 213595 7245458 ~ 7268381 (-)
LOC110528722 cfap47 coding upstream 238761 7270624 ~ 7283445 (-)
zc3h13 LOC106575915 coding upstream 263487 7295350 ~ 7311023 (-)
G571519 NA non-coding downstream 51386 6975050 ~ 6975314 (-)
LOC118965229 LOC106575791 non-coding downstream 180045 6845525 ~ 6849716 (-)
G571415 NA non-coding downstream 190120 6835670 ~ 6836580 (-)
G571478 NA non-coding downstream 209557 6814968 ~ 6817143 (-)
G571588 NA non-coding upstream 105333 7137196 ~ 7137474 (-)
G571590 NA non-coding upstream 111266 7143129 ~ 7143428 (-)
G571574 NA non-coding upstream 116640 7148503 ~ 7149487 (-)
G571597 NA non-coding upstream 133646 7165509 ~ 7167778 (-)
G571598 NA non-coding upstream 137700 7169563 ~ 7169910 (-)
G571166 LOC100380696 other downstream 915563 6091286 ~ 6111137 (-)
G571160 LOC106575668 other downstream 976698 6041168 ~ 6050002 (-)
G571129 LOC100136391 other downstream 1124110 5895015 ~ 5902590 (-)
G571076 NA other downstream 1249460 5766818 ~ 5777240 (-)
G571637 NA other upstream 283365 7315228 ~ 7316077 (-)
LOC110496980 zranb3 other upstream 304647 7335591 ~ 7413148 (-)
G571715 NA other upstream 441505 7473368 ~ 7473641 (-)
G571748 NA other upstream 542964 7574827 ~ 7578444 (-)
LOC110512526 mbd5 other upstream 690856 7708177 ~ 7728376 (-)

Expression


G571538 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G571538 Expression in each Bioproject

Bar chart with 14 bars.
G571538 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network