G571715



Basic Information


Item Value
gene id G571715
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 7473368 ~ 7473641 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU651742
aaaggactctcagaccatgagaaacaagattgaacactttggcctgaatgccaagtgtcatgtctggaggagacctggcaccattcctactgtgaagcatggtggtggcagcatcatgctgtggggatgcttttcagcggcagggactgggagactagtcaggatccaaggaaagatgaacggagcaaagtacagagagatcctttatgaaaacctgctccagaaagctcaggatctcagactggggcaaaagttcaccttccaacaggacaac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU651742 True 274 TUCP 0.50 1 7473368 7473641

Neighbor


gene id symbol gene type direction distance location
LOC110496980 zranb3 coding downstream 60220 7335591 ~ 7413148 (-)
zc3h13 LOC106575915 coding downstream 162345 7295350 ~ 7311023 (-)
LOC110528722 cfap47 coding downstream 189923 7270624 ~ 7283445 (-)
LOC110511494 cfap47 coding downstream 204987 7245458 ~ 7268381 (-)
LOC118965339 cfap47 coding downstream 228139 7224217 ~ 7245229 (-)
LOC110495391 lypd6 coding upstream 160041 7633682 ~ 7659195 (-)
LOC110492730 LOC105022551 coding upstream 202166 7675807 ~ 7707876 (-)
LOC110512526 mbd5 coding upstream 234536 7708177 ~ 7728376 (-)
LOC110495501 LOC106574754 coding upstream 299123 7772764 ~ 7777537 (-)
cbs cbs coding upstream 309642 7783283 ~ 7801248 (-)
G571713 NA non-coding downstream 2138 7469128 ~ 7471230 (-)
G571712 NA non-coding downstream 5654 7467360 ~ 7467714 (-)
G571711 NA non-coding downstream 6463 7466540 ~ 7466905 (-)
G571704 LOC106574832 non-coding downstream 7701 7463184 ~ 7465667 (-)
G571696 NA non-coding downstream 37309 7434966 ~ 7436059 (-)
G571716 NA non-coding upstream 240 7473881 ~ 7474117 (-)
G571718 NA non-coding upstream 8409 7482050 ~ 7482511 (-)
G571720 NA non-coding upstream 11768 7485409 ~ 7485628 (-)
G571724 NA non-coding upstream 16838 7490479 ~ 7490758 (-)
G571725 NA non-coding upstream 20618 7494259 ~ 7495402 (-)
G571637 NA other downstream 157291 7315228 ~ 7316077 (-)
G571538 NA other downstream 441505 7026700 ~ 7031863 (-)
LOC110495631 LOC106575789 other downstream 609602 6850467 ~ 6863766 (-)
G571166 LOC100380696 other downstream 1362231 6091286 ~ 6111137 (-)
G571748 NA other upstream 101186 7574827 ~ 7578444 (-)
G571862 NA other upstream 428540 7902181 ~ 7902649 (-)
G571906 LOC106574801 other upstream 505819 7979460 ~ 7992063 (-)
LOC110495546 dnpep other upstream 523495 7997136 ~ 8012937 (-)

Expression


G571715 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G571715 Expression in each Bioproject

Bar chart with 17 bars.
G571715 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network