G573743



Basic Information


Item Value
gene id G573743
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 10349709 ~ 10350718 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU654205
CTTCTTTTGTAAGATTGAGCTCCCTACTATCTCCGAAGAGCAGAGGTCCCTCCTTAATGCCCCTATTACCAAGGAAGAGATAATGTTCGCAATTAAGAATCTGCAAAATGGTAAGGCCCCAGGACCAGACGGGTTTTGTAGTGAGTTCTATAAAGAGTTCCATGGCCTGATCCTTGAGCCATTGCGTGATATGTTTAATCACTCATTTTCAAATGACCAACTCCCTCAAACGCTGAGAGAAGCCAACATTTCACTTATTCTCAAAAAGGGAAAATGTCCAGAGTCTTGTTCCTCGTACAGACCAATTTCCCTTCTGAATGTGGATAGAAAATTGCTTTCTAAAATTCTAGCCACAAGATTAGAGGACTCACTGCCACTAATTGTGAAAGGAGACCAAACTGGCTTCATTAAGGGCCGTAAGTCATGCAACAATGTCAGGCAGCTTCTTAATGTAATTCAAGCCTACCAACAAAGTGCTGTGGATGGACTTGTGCTCCCTCTAGATGCTGAGAAAGCATTTGATCATGTAGAG

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU654205 True 532 TUCP 0.42 2 10349709 10350718
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118965242 LOC106574692 coding downstream 24125 10259338 ~ 10325584 (-)
LOC118965243 NA coding downstream 51690 10296624 ~ 10298019 (-)
LOC118965241 ackr3 coding downstream 175481 10166025 ~ 10174228 (-)
LOC110516772 LOC100505417 coding downstream 262790 10085183 ~ 10086919 (-)
LOC110513724 LOC106574782 coding downstream 270110 10055240 ~ 10079599 (-)
si:dkey-222p3.1 NA coding upstream 21725 10372443 ~ 10375376 (-)
LOC110527191 NA coding upstream 230178 10580896 ~ 10588969 (-)
LOC110527192 LOC106574768 coding upstream 266335 10617053 ~ 10641319 (-)
LOC110527088 NA coding upstream 301760 10652478 ~ 10654005 (-)
LOC110527190 NA coding upstream 307225 10657821 ~ 10679853 (-)
G573742 NA non-coding downstream 106 10349276 ~ 10349603 (-)
G573739 NA non-coding downstream 4113 10345257 ~ 10345596 (-)
G573738 pol3 non-coding downstream 4824 10344482 ~ 10344885 (-)
G573737 LOC106584613 non-coding downstream 7272 10339219 ~ 10342437 (-)
G573736 NA non-coding downstream 10847 10338490 ~ 10338862 (-)
G573746 NA non-coding upstream 5919 10356637 ~ 10356921 (-)
G573749 NA non-coding upstream 11087 10361805 ~ 10362101 (-)
G573750 NA non-coding upstream 11452 10362170 ~ 10362464 (-)
G573751 NA non-coding upstream 14529 10365247 ~ 10367297 (-)
G573757 LOC106574751 non-coding upstream 40240 10390958 ~ 10391345 (-)
G573253 NA other downstream 472349 9875105 ~ 9877360 (-)
G573179 NA other downstream 654866 9694426 ~ 9694843 (-)
LOC110512355 LOC106575834 other downstream 1439172 8902833 ~ 8910580 (-)
LOC110527271 LOC106575866 other downstream 1731798 8616126 ~ 8621907 (-)
G573769 NA other upstream 57423 10408141 ~ 10456035 (-)
G573892 NA other upstream 329237 10679955 ~ 10681763 (-)
G574619 NA other upstream 856620 11207338 ~ 11207793 (-)
LOC110528724 LOC106575641 other upstream 1322039 11655683 ~ 11730452 (-)
LOC110515532 NA other upstream 1490204 11840744 ~ 11844731 (-)

Expression


G573743 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G573743 Expression in each Bioproject

Bar chart with 20 bars.
G573743 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network