G575315



Basic Information


Item Value
gene id G575315
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 11920366 ~ 11920846 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU656072
GGGCTAGACTGTCCCCCTCCCAGGACTGGCCCGGAGGATCACACACATCCCCTCACTTCTTCCCGTGTCCTTGACACCAGACCTGCGGAATTCAAGTGGATGGAAAACCACCGTTCCCATTTCCCAGTATCCACTGCTTTTCACACATAATATACAATACATTCATTTCGCAGAGAGTGACTGCAATACATGTCGCGACGTGAGGAAGATTCTGGAATATTTACTGAATACACAGCACAGTACTCACTCCACATGAATTCTGAATTCTGATCTGGAGAGAATGACAGGAGGGGAACGGGACGATGGAACAGCTGAAGAGAAATAGAACCCTCAACACACGTCAAGGTCACTGGCAGGCTGGTGTGAAGGTCAGAACTTAACATGACGTTTAGAAACAGACATTCAACTGTAAATCCAATTGGTGATCTAACTGTTAGCCACAGTGTCCGTTTCCTGTAGGCCTCCCTGTTGAGAAAATAAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU656072 True 481 lncRNA 0.47 1 11920366 11920846

Neighbor


gene id symbol gene type direction distance location
LOC110515532 NA coding downstream 75635 11840744 ~ 11844731 (-)
LOC110495471 LOC106575630 coding downstream 110708 11791209 ~ 11809658 (-)
LOC110497003 LOC106575637 coding downstream 145965 11769813 ~ 11774401 (-)
LOC110495475 LOC106575627 coding downstream 176639 11742450 ~ 11743727 (-)
LOC110528724 LOC106575641 coding downstream 189914 11655683 ~ 11730452 (-)
LOC110528844 igfbp-2a coding upstream 267058 12187904 ~ 12204994 (-)
LOC110528842 inh coding upstream 354800 12275646 ~ 12277419 (-)
LOC110528827 LOC106574694 coding upstream 443257 12364103 ~ 12392300 (-)
LOC110528833 LOC106574707 coding upstream 553421 12474267 ~ 12485521 (-)
LOC110527309 LOC106575526 coding upstream 672187 12593033 ~ 12599186 (-)
G575314 NA non-coding downstream 6930 11913130 ~ 11913436 (-)
G575313 NA non-coding downstream 11555 11908573 ~ 11908811 (-)
G575312 NA non-coding downstream 14101 11897588 ~ 11906265 (-)
G575311 NA non-coding downstream 27739 11892176 ~ 11892627 (-)
G575310 NA non-coding downstream 28817 11890990 ~ 11891549 (-)
G575318 NA non-coding upstream 4321 11925167 ~ 11925367 (-)
G575319 NA non-coding upstream 8556 11929402 ~ 11929739 (-)
G575321 NA non-coding upstream 11140 11931986 ~ 11932212 (-)
G575323 NA non-coding upstream 25531 11946377 ~ 11946636 (-)
G575342 NA non-coding upstream 69882 11990728 ~ 11991099 (-)
G574619 NA other downstream 712573 11207338 ~ 11207793 (-)
G573892 NA other downstream 1238603 10679955 ~ 10681763 (-)
G573769 NA other downstream 1464331 10408141 ~ 10456035 (-)
G575380 NA other upstream 150585 12071431 ~ 12187360 (-)
G575511 NA other upstream 357730 12278576 ~ 12278893 (-)
G575666 NA other upstream 427800 12348646 ~ 12349739 (-)
G575725 NA other upstream 539783 12460629 ~ 12461052 (-)
G575727 NA other upstream 541270 12462116 ~ 12462541 (-)

Expression


G575315 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.75.
End of interactive chart.

G575315 Expression in each Bioproject

Bar chart with 8 bars.
G575315 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.

Co-expression Network