G575723



Basic Information


Item Value
gene id G575723
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 12457899 ~ 12458227 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU656531
gatattatctgtgagtgccacagaactcatgctacaggcgaaaccaagatgaaacttcaaacaggaaatgagcagaatttctgaagctctgttttccaatgtctccttatatggctgtgaatgcaccaggaacgagcctgcgctttctgttgtttcttcaagatgtctgcagcattgtgacgtatttgtaggcatatcattggaagattggccataagagactacattttccaggggtccgcccggtgtcctttgtctaaattggtgcgtaatcttcagttgcggtcattttctcctgggattcaggacagaaagcacacttccacaaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU656531 True 329 lncRNA 0.44 1 12457899 12458227
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528827 LOC106574694 coding downstream 65599 12364103 ~ 12392300 (-)
LOC110528842 inh coding downstream 180480 12275646 ~ 12277419 (-)
LOC110528844 igfbp-2a coding downstream 252905 12187904 ~ 12204994 (-)
LOC110515532 NA coding downstream 613168 11840744 ~ 11844731 (-)
LOC110495471 LOC106575630 coding downstream 648241 11791209 ~ 11809658 (-)
LOC110528833 LOC106574707 coding upstream 16040 12474267 ~ 12485521 (-)
LOC110527309 LOC106575526 coding upstream 134806 12593033 ~ 12599186 (-)
LOC110527310 LOC106574666 coding upstream 141785 12600012 ~ 12602688 (-)
LOC110527312 LOC106575588 coding upstream 277515 12735742 ~ 12741080 (-)
LOC118965248 NA coding upstream 380099 12838326 ~ 12845168 (-)
G575720 NA non-coding downstream 2947 12454653 ~ 12454952 (-)
G575711 NA non-coding downstream 22248 12435143 ~ 12435651 (-)
G575695 NA non-coding downstream 50129 12407150 ~ 12407770 (-)
G575687 NA non-coding downstream 63212 12394110 ~ 12394687 (-)
G575686 NA non-coding downstream 64990 12392636 ~ 12392909 (-)
G575728 NA non-coding upstream 4860 12463087 ~ 12463350 (-)
G575729 NA non-coding upstream 5626 12463853 ~ 12464063 (-)
G575731 LOC106574706 non-coding upstream 6927 12465154 ~ 12468716 (-)
G575735 NA non-coding upstream 28360 12486587 ~ 12486796 (-)
G575666 NA other downstream 108160 12348646 ~ 12349739 (-)
G575511 NA other downstream 179006 12278576 ~ 12278893 (-)
G575380 NA other downstream 270539 12071431 ~ 12187360 (-)
LOC110528724 LOC106575641 other downstream 769990 11655683 ~ 11730452 (-)
G575725 NA other upstream 2402 12460629 ~ 12461052 (-)
G575727 NA other upstream 3889 12462116 ~ 12462541 (-)
LOC118965250 NA other upstream 471551 12927297 ~ 12933016 (-)
cu051 NA other upstream 630496 13088723 ~ 13092894 (-)

Expression


G575723 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G575723 Expression in each Bioproject

Bar chart with 18 bars.
G575723 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network