G576567



Basic Information


Item Value
gene id G576567
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 13226924 ~ 13233244 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU657582
atcataggtacacttaaactatgacagacaaaatgagagagaaaaaatccagaaaatcacattgtaggatttttaattaatttatttgcaaattatggtggaaaataagtatttgttcacctacaaacaagcaagatttctggctctcacagacctgtaacttcttctttaagaggctcctctgtcctccactcgttacctgtattaatggcacctgtttgaacttgttatcagtataaaagacacctgtccacaacctcaaacagtcacactccaaactccactatggccaagaccaaagagctgtcaaaggacaccagaaacaaaattgtagacctgcaccaggctgggaagactgaatctgcaataggtaaggagcttggtttgaagaaatcaactgtgggagcaatttttaggaaatggaagacatacaagaccactgataatctccatcgatctggggctccacgcaagatctcaccccgtggggtcaaaatgatcacaggaacggtgagcaaaaatcccagaaccacacggggggacctagtgaat

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU657582 True 552 TUCP 0.42 2 13226924 13233244

Neighbor


gene id symbol gene type direction distance location
LOC118965251 NA coding downstream 7499 13217458 ~ 13219425 (-)
cu051 NA coding downstream 134090 13088723 ~ 13092894 (-)
LOC110497060 LOC106575573 coding downstream 151975 13058820 ~ 13074949 (-)
LOC110527326 LOC106574394 coding downstream 254056 12925528 ~ 12972868 (-)
LOC118965250 NA coding downstream 293908 12927297 ~ 12933016 (-)
LOC118965252 NA coding upstream 51472 13284716 ~ 13295958 (-)
LOC118965253 LOC106575469 coding upstream 63195 13296439 ~ 13307036 (-)
LOC110527331 LOC106592161 coding upstream 100355 13333599 ~ 13358122 (-)
gpr180 LOC106575501 coding upstream 210361 13443605 ~ 13451718 (-)
LOC110527338 LOC106575550 coding upstream 228486 13461730 ~ 13482918 (-)
LOC110527330 NA non-coding downstream 14847 13197408 ~ 13256441 (-)
G576537 NA non-coding downstream 53842 13172766 ~ 13173082 (-)
G576513 NA non-coding downstream 66645 13159967 ~ 13160279 (-)
G576510 NA non-coding downstream 71692 13154980 ~ 13155232 (-)
G576482 LOC100380633 non-coding downstream 82381 13124958 ~ 13144543 (-)
G576590 NA non-coding upstream 36902 13270146 ~ 13275187 (-)
G576675 NA non-coding upstream 195929 13429173 ~ 13429381 (-)
G576682 NA non-coding upstream 203784 13437028 ~ 13437329 (-)
G576691 NA non-coding upstream 224709 13457953 ~ 13458470 (-)
G576671 NA non-coding upstream 227893 13461137 ~ 13461428 (-)
LOC110527310 LOC106574666 other downstream 624286 12600012 ~ 12602688 (-)
G575727 NA other downstream 764383 12462116 ~ 12462541 (-)
G575725 NA other downstream 765872 12460629 ~ 12461052 (-)
G576519 LOC106575469 other upstream 67292 13300536 ~ 13358009 (-)
G576667 NA other upstream 186445 13419689 ~ 13423705 (-)
G577067 NA other upstream 586532 13819776 ~ 13824029 (-)
LOC110527361 LOC106574632 other upstream 935127 14168168 ~ 14172184 (-)
G577582 NA other upstream 1192776 14426020 ~ 14426696 (-)

Expression


G576567 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G576567 Expression in each Bioproject

Bar chart with 20 bars.
G576567 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network