G579279



Basic Information


Item Value
gene id G579279
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 16465784 ~ 16466236 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU660945
atatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtcagttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacagcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU660945 True 453 lncRNA 0.41 1 16465784 16466236
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528876 LOC106574510 coding downstream 18998 16438652 ~ 16446786 (-)
LOC118965347 LOC106574589 coding downstream 61584 16401119 ~ 16406055 (-)
LOC118965264 LOC106575381 coding downstream 132083 16327118 ~ 16333701 (-)
LOC110528901 LOC106575418 coding downstream 139215 16321126 ~ 16326569 (-)
LOC110528887 LOC106574501 coding downstream 144990 16316980 ~ 16320794 (-)
LOC110528867 LOC106575374 coding upstream 93694 16559930 ~ 16635251 (-)
LOC118936279 LOC106575378 coding upstream 118268 16584504 ~ 16587496 (-)
LOC118936280 LOC106575375 coding upstream 132130 16598366 ~ 16607601 (-)
LOC118936281 LOC106575370 coding upstream 170137 16636373 ~ 16646468 (-)
LOC110528860 LOC106575367 coding upstream 230003 16696239 ~ 16701916 (-)
G579277 NA non-coding downstream 1001 16464121 ~ 16464783 (-)
G579274 NA non-coding downstream 7834 16457698 ~ 16457950 (-)
G579273 NA non-coding downstream 11791 16453675 ~ 16453993 (-)
G579272 NA non-coding downstream 12840 16452079 ~ 16452944 (-)
G579283 NA non-coding upstream 12918 16479154 ~ 16479520 (-)
G579294 NA non-coding upstream 43040 16509276 ~ 16509482 (-)
G579295 LOC106575379 non-coding upstream 69665 16535901 ~ 16537923 (-)
G579322 NA non-coding upstream 77792 16544028 ~ 16544235 (-)
G579278 NA other downstream 250 16464942 ~ 16465534 (-)
G579125 LOC106574487 other downstream 335467 16129493 ~ 16130317 (-)
G579102 NA other downstream 392638 16072869 ~ 16073146 (-)
G579028 NA other downstream 502241 15897176 ~ 15963543 (-)
LOC110527396 LOC106574529 other upstream 331444 16797680 ~ 16800686 (-)
G580487 NA other upstream 931621 17397857 ~ 17400536 (-)
G581089 LOC106575297 other upstream 1576691 18042927 ~ 18043380 (-)
G581174 LOC101077481 other upstream 1750922 18217158 ~ 18235038 (-)

Expression


G579279 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G579279 Expression in each Bioproject

Bar chart with 19 bars.
G579279 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network