G580194


Basic Information

Item Value
gene id G580194
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 17402669 ~ 17402925 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU662057
cgtactttggtgcaaaaagtgcaaattaattccaaatcaaatcaaattttatttgtcacatacacatggttagcagatgttaatgcgagtgtagcgaaatgcttgtgcttctagttccgacaatgcagtaataacaagtaatctaactaacaattccaaaactactgtcttgtacacagtgtaaggggataaagaatatgtacataaggatatatgaatgagtgatggtacagagcagcataggcaagatacagtag

Function

NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU662057 True 257 lncRNA 0.35 1 17402669 17402925

Neighbor

gene id symbol gene type direction distance location
LOC110527410 LOC106575311 coding upstream 4651 17372378 ~ 17398018 (+)
si:ch211-181l5.2 cl10a coding upstream 66250 17333699 ~ 17336419 (+)
LOC110527408 LOC106574552 coding upstream 70832 17328880 ~ 17331837 (+)
LOC118965348 LOC106574556 coding upstream 76318 17322665 ~ 17326351 (+)
LOC110528799 LOC106575315 coding upstream 142374 17216928 ~ 17260295 (+)
LOC100136600 LOC106574550 coding downstream 65422 17468347 ~ 17473938 (+)
abcb11b LOC106575306 coding downstream 81450 17484375 ~ 17496205 (+)
LOC100136260 LOC100195750 coding downstream 111311 17514236 ~ 17518488 (+)
LOC110527418 LOC106575302 coding downstream 323965 17726890 ~ 17750107 (+)
LOC110528802 LOC106574564 coding downstream 489030 17891955 ~ 17929312 (+)
G580192 NA non-coding upstream 853 17401555 ~ 17401816 (+)
G580190 NA non-coding upstream 8359 17393903 ~ 17394310 (+)
G580184 NA non-coding upstream 18473 17383971 ~ 17384196 (+)
G580178 NA non-coding upstream 31096 17371134 ~ 17371573 (+)
G580169 NA non-coding upstream 37412 17364974 ~ 17365257 (+)
G580196 NA non-coding downstream 1915 17404840 ~ 17405397 (+)
G580202 NA non-coding downstream 9942 17412867 ~ 17427008 (+)
G580212 NA non-coding downstream 28173 17431098 ~ 17431336 (+)
G580246 NA non-coding downstream 126479 17529404 ~ 17529612 (+)
G580250 NA non-coding downstream 136688 17539613 ~ 17539860 (+)
G580179 NA other upstream 2136 17398793 ~ 17400533 (+)
LOC110527403 LOC106574539 other upstream 304745 17042409 ~ 17097924 (+)
G579566 NA other upstream 582779 16818542 ~ 16819890 (+)
LOC110528786 omp-1 other upstream 938977 16457220 ~ 16463699 (+)
G580315 LOC106575303 other downstream 267350 17670275 ~ 17680668 (+)
G580365 NA other downstream 410417 17813342 ~ 17816848 (+)
G580997 NA other downstream 1089302 18492227 ~ 18492909 (+)
G581976 LOC106581475 other downstream 1573753 18976678 ~ 18976999 (+)
LOC110528807 LOC106574429 other downstream 2614930 20017855 ~ 20028775 (+)

Expression


Co-expression Network