G580264



Basic Information


Item Value
gene id G580264
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 17565444 ~ 17566443 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU662134
cctcccagctgcataggctcagctcccgagccggcagaggaagatggtagtgatgcggagaggggggcaacggagagcgcgagctcctttccacgagctcggtgacgaagatcaacccgtcgctcaatgcgaatagcgagttcaatcaaggaatccacgctggaaggaacctcccgggagagaatctcatcctttacctctgcgcggagaccctccagaagacgagcgagcaaagccggctcgttccagccactggaggcagcaagagtgcgaaactcaatagagtagtctgttatggatcgattgccttgacatagggaagacagggccctggaagcctcctccccaaaaacagatcgatcaaaaacctgtatcatctcctccttaaagtcctgatactggttagtacactcagcccttgcctcccagattgccgtgccccactcacgagcctgtccagtaaggagagatatgacgtaggcgacacgagcagtgctcctggcgtaagtgttgggctggagagaaaacacaatatcacactgggtgaggaacgagcggcattcagtgggctccccagagtaacacggcgggttattgattctgggctccggagattcgaaagccctggaagtggccggtggatcgaggcggagatggtgaacctgttctgtgaggttggagacttgggtggccagggtctcaacggcatgtcgagcagcagacaattcctgctcgtgtctgcctagcatcgctccctggatctcgacggctgagtggagaggatccgaagtcgctgggtccattcttggtcggattcttctgtcaggtgcgtgaatgaggacccaaaagcgaattaacgtaaacagagcttctttaataacaaaacaaaacgtaggctcagatggaccggcaggttccgacaggacaggacaaggttgcagcaaacatgacgatagtctggttcaggcatgaacaacacaaacaagaatccgacaaggac

Function


NR:

description
PREDICTED: protein LDOC1-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU662134 True 1000 lncRNA 0.54 1 17565444 17566443

Neighbor


gene id symbol gene type direction distance location
LOC100136260 LOC100195750 coding upstream 46956 17514236 ~ 17518488 (+)
abcb11b LOC106575306 coding upstream 69239 17484375 ~ 17496205 (+)
LOC100136600 LOC106574550 coding upstream 91506 17468347 ~ 17473938 (+)
LOC110527410 LOC106575311 coding upstream 167426 17372378 ~ 17398018 (+)
si:ch211-181l5.2 cl10a coding upstream 229025 17333699 ~ 17336419 (+)
LOC110527418 LOC106575302 coding downstream 160447 17726890 ~ 17750107 (+)
LOC110528802 LOC106574564 coding downstream 325512 17891955 ~ 17929312 (+)
LOC110527422 LOC106575297 coding downstream 435890 18002333 ~ 18079999 (+)
LOC110527424 LOC106575296 coding downstream 530014 18096457 ~ 18107236 (+)
gcg2 gcg2 coding downstream 542347 18108790 ~ 18111651 (+)
G580263 NA non-coding upstream 3238 17561800 ~ 17562206 (+)
G580260 NA non-coding upstream 13751 17551492 ~ 17551693 (+)
G580259 NA non-coding upstream 14556 17550332 ~ 17550888 (+)
G580254 NA non-coding upstream 21010 17544229 ~ 17544434 (+)
G580253 NA non-coding upstream 21711 17542992 ~ 17543733 (+)
G580269 NA non-coding downstream 11734 17578177 ~ 17578897 (+)
G580270 NA non-coding downstream 12515 17578958 ~ 17579176 (+)
G580272 NA non-coding downstream 16906 17583349 ~ 17583629 (+)
G580279 NA non-coding downstream 27181 17593624 ~ 17593985 (+)
G580280 NA non-coding downstream 28098 17594541 ~ 17594826 (+)
G580179 NA other upstream 164911 17398793 ~ 17400533 (+)
LOC110527403 LOC106574539 other upstream 467520 17042409 ~ 17097924 (+)
G579566 NA other upstream 745554 16818542 ~ 16819890 (+)
LOC110528786 omp-1 other upstream 1101752 16457220 ~ 16463699 (+)
G580315 LOC106575303 other downstream 103832 17670275 ~ 17680668 (+)
G580365 NA other downstream 246899 17813342 ~ 17816848 (+)
G580997 NA other downstream 925784 18492227 ~ 18492909 (+)
G581976 LOC106581475 other downstream 1410235 18976678 ~ 18976999 (+)
LOC110528807 LOC106574429 other downstream 2451412 20017855 ~ 20028775 (+)

Expression


G580264 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G580264 Expression in each Bioproject

Bar chart with 20 bars.
G580264 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network