G580280



Basic Information


Item Value
gene id G580280
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 17594541 ~ 17594826 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU662150
agatactggtgcagagtcaatgtggaggctatatacagggggtactggtacagagtcaatgtggaggctatatacaggggatactggtacagagtcaatgtggaggctatatacaggggatactggtacagagtcaatgtggaggctatatacaggggatactggtacagagtcaatgtggaggctatatacaggagatactggtacagagtcaatgtggaggctatatacaggggatactggtacagagtcaatgtggaggctatatacaggggatactggtaca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU662150 True 286 lncRNA 0.46 1 17594541 17594826
Loading

Neighbor


gene id symbol gene type direction distance location
LOC100136260 LOC100195750 coding upstream 76053 17514236 ~ 17518488 (+)
abcb11b LOC106575306 coding upstream 98336 17484375 ~ 17496205 (+)
LOC100136600 LOC106574550 coding upstream 120603 17468347 ~ 17473938 (+)
LOC110527410 LOC106575311 coding upstream 196523 17372378 ~ 17398018 (+)
si:ch211-181l5.2 cl10a coding upstream 258122 17333699 ~ 17336419 (+)
LOC110527418 LOC106575302 coding downstream 132064 17726890 ~ 17750107 (+)
LOC110528802 LOC106574564 coding downstream 297129 17891955 ~ 17929312 (+)
LOC110527422 LOC106575297 coding downstream 407507 18002333 ~ 18079999 (+)
LOC110527424 LOC106575296 coding downstream 501631 18096457 ~ 18107236 (+)
gcg2 gcg2 coding downstream 513964 18108790 ~ 18111651 (+)
G580279 NA non-coding upstream 556 17593624 ~ 17593985 (+)
G580272 NA non-coding upstream 10912 17583349 ~ 17583629 (+)
G580270 NA non-coding upstream 15365 17578958 ~ 17579176 (+)
G580269 NA non-coding upstream 15644 17578177 ~ 17578897 (+)
G580264 NA non-coding upstream 28098 17565444 ~ 17566443 (+)
G580284 NA non-coding downstream 5358 17600184 ~ 17600388 (+)
G580291 NA non-coding downstream 15981 17610807 ~ 17611028 (+)
G580298 NA non-coding downstream 28416 17623242 ~ 17623455 (+)
G580320 NA non-coding downstream 49711 17644537 ~ 17644838 (+)
G580321 NA non-coding downstream 50217 17645043 ~ 17645305 (+)
G580179 NA other upstream 194008 17398793 ~ 17400533 (+)
LOC110527403 LOC106574539 other upstream 496617 17042409 ~ 17097924 (+)
G579566 NA other upstream 774651 16818542 ~ 16819890 (+)
LOC110528786 omp-1 other upstream 1130849 16457220 ~ 16463699 (+)
G580315 LOC106575303 other downstream 75449 17670275 ~ 17680668 (+)
G580365 NA other downstream 218516 17813342 ~ 17816848 (+)
G580997 NA other downstream 897401 18492227 ~ 18492909 (+)
G581976 LOC106581475 other downstream 1381852 18976678 ~ 18976999 (+)
LOC110528807 LOC106574429 other downstream 2423029 20017855 ~ 20028775 (+)

Expression


G580280 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G580280 Expression in each Bioproject

Bar chart with 18 bars.
G580280 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network