G582651



Basic Information


Item Value
gene id G582651
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 19469473 ~ 19469806 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU664735
ggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggatgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcttcacaaaaaaatacagttttatatctttatgtttgaagcctgaaatgtggcaaaaggtcgcaaagttcaaggggggcgaatactttc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU664735 True 334 lncRNA 0.36 1 19469473 19469806
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110527441 NA coding downstream 288383 19176035 ~ 19181090 (-)
LOC110527100 NA coding downstream 314874 19145757 ~ 19154599 (-)
LOC118965376 NA coding downstream 323899 19142146 ~ 19145574 (-)
LOC110527440 LOC106575280 coding downstream 400635 19062829 ~ 19068838 (-)
LOC110527435 LOC106574410 coding downstream 1067677 18384671 ~ 18401796 (-)
LOC110527445 nfip2 coding upstream 353825 19823631 ~ 19832571 (-)
LOC110527446 LOC106574421 coding upstream 381998 19851804 ~ 19881758 (-)
cfap221 cfap221 coding upstream 527550 19997356 ~ 20017679 (-)
LOC110527451 LOC106575269 coding upstream 558828 20028634 ~ 20038269 (-)
LOC110528808 steap3 coding upstream 568674 20038480 ~ 20046983 (-)
G582637 NA non-coding downstream 7951 19461281 ~ 19461522 (-)
G582624 NA non-coding downstream 15486 19453761 ~ 19453987 (-)
G582619 NA non-coding downstream 17954 19451035 ~ 19451519 (-)
G582617 NA non-coding downstream 18572 19450409 ~ 19450901 (-)
G582600 NA non-coding downstream 30539 19438711 ~ 19438934 (-)
G582668 NA non-coding upstream 12902 19482708 ~ 19483192 (-)
G582673 NA non-coding upstream 17385 19487191 ~ 19487757 (-)
G582686 NA non-coding upstream 29150 19498956 ~ 19499159 (-)
G582807 NA non-coding upstream 116504 19586310 ~ 19586555 (-)
G582810 NA non-coding upstream 119320 19589126 ~ 19589369 (-)
G581174 LOC101077481 other downstream 1234435 18217158 ~ 18235038 (-)
G581089 LOC106575297 other downstream 1426093 18042927 ~ 18043380 (-)
G580487 NA other downstream 2068937 17397857 ~ 17400536 (-)
LOC110527396 LOC106574529 other downstream 2668787 16797680 ~ 16800686 (-)
LOC110528867 LOC106575374 other downstream 2908328 16559930 ~ 16635251 (-)
G583661 NA other upstream 745843 20215649 ~ 20249985 (-)
otos2 LOC106575250 other upstream 1303061 20772867 ~ 20778065 (-)
LOC110527470 LOC103366558 other upstream 1368682 20838415 ~ 20839399 (-)
G585240 LOC106575179 other upstream 1951648 21421454 ~ 21424585 (-)
LOC110527499 LOC106575189 other upstream 2047589 21513832 ~ 21583054 (-)

Expression


G582651 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G582651 Expression in each Bioproject

Bar chart with 16 bars.
G582651 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network