G582807



Basic Information


Item Value
gene id G582807
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 19586310 ~ 19586555 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU664893
gtaataaattcatgaacttctttgaggaaaatatcatgatcattagaaagcaaattacggactcctctttaaatctgcgtattcctctaaagctcagttgtcctgagtctgcacaactctgccaggtcctaggatcaagagagacactcaagtgttttagtactatatctcttgacacaatgatgaaaataatcatggcctctaaaccttcaagctgcatactggaccctattccaactaaactac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU664893 True 246 lncRNA 0.38 1 19586310 19586555

Neighbor


gene id symbol gene type direction distance location
LOC110527441 NA coding downstream 405220 19176035 ~ 19181090 (-)
LOC110527100 NA coding downstream 431711 19145757 ~ 19154599 (-)
LOC118965376 NA coding downstream 440736 19142146 ~ 19145574 (-)
LOC110527440 LOC106575280 coding downstream 517472 19062829 ~ 19068838 (-)
LOC110527435 LOC106574410 coding downstream 1184514 18384671 ~ 18401796 (-)
LOC110527445 nfip2 coding upstream 237076 19823631 ~ 19832571 (-)
LOC110527446 LOC106574421 coding upstream 265249 19851804 ~ 19881758 (-)
cfap221 cfap221 coding upstream 410801 19997356 ~ 20017679 (-)
LOC110527451 LOC106575269 coding upstream 442079 20028634 ~ 20038269 (-)
LOC110528808 steap3 coding upstream 451925 20038480 ~ 20046983 (-)
G582686 NA non-coding downstream 87151 19498956 ~ 19499159 (-)
G582673 NA non-coding downstream 98553 19487191 ~ 19487757 (-)
G582668 NA non-coding downstream 103118 19482708 ~ 19483192 (-)
G582651 NA non-coding downstream 116504 19469473 ~ 19469806 (-)
G582637 NA non-coding downstream 124788 19461281 ~ 19461522 (-)
G582810 NA non-coding upstream 2571 19589126 ~ 19589369 (-)
G582863 NA non-coding upstream 36002 19622557 ~ 19622956 (-)
G582872 NA non-coding upstream 43933 19630488 ~ 19630705 (-)
G583192 NA non-coding upstream 178554 19765109 ~ 19765326 (-)
G583199 NA non-coding upstream 187260 19773815 ~ 19774037 (-)
G581174 LOC101077481 other downstream 1351272 18217158 ~ 18235038 (-)
G581089 LOC106575297 other downstream 1542930 18042927 ~ 18043380 (-)
G580487 NA other downstream 2185774 17397857 ~ 17400536 (-)
LOC110527396 LOC106574529 other downstream 2785624 16797680 ~ 16800686 (-)
LOC110528867 LOC106575374 other downstream 3025165 16559930 ~ 16635251 (-)
G583661 NA other upstream 629094 20215649 ~ 20249985 (-)
otos2 LOC106575250 other upstream 1186312 20772867 ~ 20778065 (-)
LOC110527470 LOC103366558 other upstream 1251933 20838415 ~ 20839399 (-)
G585240 LOC106575179 other upstream 1834899 21421454 ~ 21424585 (-)
LOC110527499 LOC106575189 other upstream 1930840 21513832 ~ 21583054 (-)

Expression


G582807 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G582807 Expression in each Bioproject

Bar chart with 19 bars.
G582807 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network