G586539



Basic Information


Item Value
gene id G586539
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 22685565 ~ 22685824 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU668995
CAGTCGATGCTCTCAATCCACTTGCTGAGGTTCTGTCTGATGTCCATGGGGAAGGAGTCATCATAGAGCTGGTGGATCTGCTCCTGGTATTTAGACTCCAGTAGTGTCAGCTGGCACCACTGGGCCATCTAGAACAATGGGCAATAACAGTCAACTTATTACGAAAAAGTATGTCTATGATAGAAACAGGAACCTGACTACAACATGAATAATAATTCTCCTTTATATGCCTGGCATGCATCAGCTTGTTGTCCTCCCTT

Function


NR:

description
signal transducer and activator of transcription 1-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU668995 True 260 lncRNA 0.45 1 22685565 22685824

Neighbor


gene id symbol gene type direction distance location
mstn2a mstn2a coding downstream 5613 22678448 ~ 22679952 (-)
stat1-2 stat1-2 coding downstream 17463 22638090 ~ 22668102 (-)
LOC110527522 LOC106575212 coding downstream 65317 22609884 ~ 22620248 (-)
plcd4a LOC106575211 coding downstream 76096 22587846 ~ 22609469 (-)
fam207a cu070 coding downstream 97897 22563281 ~ 22587668 (-)
glsa LOC106575215 coding upstream 39455 22725279 ~ 22746080 (-)
LOC110527525 clcc1 coding upstream 61786 22747610 ~ 22768921 (-)
LOC110527526 LOC106575217 coding upstream 101733 22787557 ~ 22792363 (-)
LOC110527527 LOC106575218 coding upstream 112100 22797924 ~ 22807497 (-)
LOC110527529 ngl1 coding upstream 121852 22807676 ~ 22812906 (-)
G586522 NA non-coding downstream 61012 22620999 ~ 22624553 (-)
G586488 NA non-coding downstream 80532 22564482 ~ 22605033 (-)
G586398 NA non-coding downstream 141984 22486284 ~ 22543581 (-)
G586414 LOC106574278 non-coding downstream 220124 22463208 ~ 22470518 (-)
G586411 NA non-coding downstream 230741 22454261 ~ 22454824 (-)
G586541 NA non-coding upstream 1875 22687699 ~ 22703875 (-)
G586543 NA non-coding upstream 5857 22691681 ~ 22692118 (-)
G586485 NA non-coding upstream 38046 22723870 ~ 22724435 (-)
G586570 NA non-coding upstream 87583 22773407 ~ 22773606 (-)
G586574 NA non-coding upstream 94218 22780042 ~ 22780263 (-)
LOC110527506 LOC106575199 other downstream 591226 22089741 ~ 22163995 (-)
LOC110527499 LOC106575189 other downstream 1166692 21513832 ~ 21583054 (-)
G585240 LOC106575179 other downstream 1260980 21421454 ~ 21424585 (-)
G586878 NA other upstream 398666 23084490 ~ 23087137 (-)
LOC110527533 s100b other upstream 476070 23161894 ~ 23165209 (-)
G587242 NA other upstream 689188 23375012 ~ 23377701 (-)
G588987 NA other upstream 2142664 24828488 ~ 24828700 (-)

Expression



Co-expression Network