G587351



Basic Information


Item Value
gene id G587351
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 23559620 ~ 23559956 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU669914
tagcaacacagctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaatagatgggaagatggatggagccaaatacaggaccattctggaagaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttaaaaaataaacatatcgaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactaaaaac

Function


NR:

description
PREDICTED: pre-rRNA-processing protein TSR1 homolog

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU669914 True 337 lncRNA 0.43 1 23559620 23559956

Neighbor


gene id symbol gene type direction distance location
LOC110527538 LOC106575225 coding upstream 242150 23306816 ~ 23317470 (+)
aox6 LOC106575224 coding upstream 269806 23271803 ~ 23289814 (+)
LOC110527536 LOC106575223 coding upstream 328886 23227353 ~ 23230734 (+)
LOC110527535 LOC106575222 coding upstream 338617 23193574 ~ 23221003 (+)
LOC110527523 stat1-2 coding upstream 837081 22684527 ~ 22722539 (+)
LOC110527540 LOC106533352 coding downstream 49564 23609520 ~ 23621369 (+)
LOC110527542 LOC106574301 coding downstream 749882 24309838 ~ 24352001 (+)
LOC110527543 LOC106575235 coding downstream 798712 24358668 ~ 24426341 (+)
gja5b LOC106574307 coding downstream 1013450 24573406 ~ 24583614 (+)
setd4 setd4 coding downstream 1163670 24723626 ~ 24732898 (+)
G587061 NA non-coding upstream 134272 23366844 ~ 23425348 (+)
G587007 NA non-coding upstream 314646 23244719 ~ 23244974 (+)
G587001 NA non-coding upstream 317643 23241757 ~ 23241977 (+)
G586998 NA non-coding upstream 320042 23239256 ~ 23239578 (+)
G586917 NA non-coding upstream 392004 23167358 ~ 23167616 (+)
G587423 NA non-coding downstream 45795 23605751 ~ 23606028 (+)
G587460 NA non-coding downstream 80243 23640199 ~ 23640452 (+)
G587461 NA non-coding downstream 80509 23640465 ~ 23640793 (+)
G587470 NA non-coding downstream 84765 23644721 ~ 23644941 (+)
G586685 NA other upstream 544500 23010061 ~ 23015120 (+)
c7h10orf53 cssa17h10orf53 other upstream 1199393 22356500 ~ 22360232 (+)
G585573 NA other upstream 1606351 21953029 ~ 21953269 (+)
G584643 NA other upstream 2477005 21080828 ~ 21082615 (+)
G587660 NA other downstream 247766 23807722 ~ 23808000 (+)
G588755 NA other downstream 1344375 24904331 ~ 24905581 (+)
G589734 NA other downstream 2043649 25587088 ~ 25608606 (+)
G589933 NA other downstream 2443974 26003930 ~ 26025309 (+)

Expression


G587351 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G587351 Expression in each Bioproject

Bar chart with 20 bars.
G587351 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network