G587696



Basic Information


Item Value
gene id G587696
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 23806674 ~ 23806916 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU670292
atgtcaggtagtcctggggcatggtcctagggctcaggtcctccgagagagagaaagagagaaggagagaattagagaacgcacacttagattcccacaggacaccgaataggacaggagaagtactccagatataacaaactgaccctagccccccgacacataaacaactgcagcataaatactggaggctgagacaggaggggtcaggagacactgtggccccatccgaggacacccccg

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU670292 True 243 lncRNA 0.53 1 23806674 23806916

Neighbor


gene id symbol gene type direction distance location
LOC110528816 LOC106575230 coding downstream 253746 23392907 ~ 23552928 (-)
LOC118965272 NA coding downstream 477058 23327046 ~ 23329616 (-)
LOC110527539 LOC106575227 coding downstream 486117 23317589 ~ 23320557 (-)
LOC110527533 s100b coding downstream 641968 23161894 ~ 23165209 (-)
LOC110527532 LOC106575221 coding downstream 673030 23106642 ~ 23133644 (-)
LOC110527541 LOC106575232 coding upstream 51592 23858508 ~ 23934010 (-)
LOC110527544 LOC106574304 coding upstream 591948 24394807 ~ 24447012 (-)
LOC110527545 LOC106575074 coding upstream 656172 24463088 ~ 24467224 (-)
LOC110527546 fstl1 coding upstream 660926 24467842 ~ 24492424 (-)
LOC110527104 NA coding upstream 712229 24519145 ~ 24527712 (-)
G587559 NA non-coding downstream 78366 23728054 ~ 23728308 (-)
G587534 NA non-coding downstream 104987 23701468 ~ 23701687 (-)
G587533 NA non-coding downstream 105630 23700750 ~ 23701044 (-)
G587524 NA non-coding downstream 110335 23695996 ~ 23696339 (-)
G587511 NA non-coding downstream 119509 23686928 ~ 23687165 (-)
G587697 NA non-coding upstream 414 23807330 ~ 23807712 (-)
G587705 NA non-coding upstream 14195 23821111 ~ 23821350 (-)
G587715 NA non-coding upstream 21927 23828843 ~ 23829099 (-)
G587736 NA non-coding upstream 35562 23842478 ~ 23842720 (-)
G587828 NA non-coding upstream 102132 23909048 ~ 23909618 (-)
G587242 NA other downstream 428973 23375012 ~ 23377701 (-)
G586878 NA other downstream 719537 23084490 ~ 23087137 (-)
LOC110527529 ngl1 other downstream 994171 22807676 ~ 22812906 (-)
LOC110527522 LOC106575212 other downstream 1186558 22609884 ~ 22620248 (-)
G588987 NA other upstream 1021572 24828488 ~ 24828700 (-)
G589093 NA other upstream 1164697 24971613 ~ 24979107 (-)
G589529 NA other upstream 1394490 25201406 ~ 25278874 (-)
LOC110527565 LOC106575142 other upstream 1441764 25215219 ~ 25290844 (-)
G589705 NA other upstream 1737819 25544735 ~ 25545418 (-)

Expression


G587696 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G587696 Expression in each Bioproject

Bar chart with 13 bars.
G587696 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network