G588622 (cbr1)


Basic Information

Item Value
gene id G588622
gene name cbr1
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 24694821 ~ 24723107 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU671295
GCATTTTTAAAGGCAATCCCAGCATTGTTAATGAGCACATCAAGGCCACCGTATTTCTCATTGAAGAAATCTCGGGCCGCCCGCACACTTTCTGGGTTGTCGATGTCAAGCTGTTGGAAGAGGGGTTTCAGCCCTTCAGAATTCAGGCTCTCCACAGCCGCTGTGCCACGGCCAGCATCCCGGCCACTGAGGAAAACATCACCATTGAATTGCTTGCAAAGCGACCGCACAATTGCAAATCCAATCCCCTTATTGGAACCAGTCACCAGTGCAACTTTTGG

Function

symbol description
cbr1 Orthologous to several human genes including CBR1 (carbonyl reductase 1).

NR:

description
carbonyl reductase [NADPH] 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU671295 True 281 lncRNA 0.51 2 24694821 24723107

Neighbor

gene id symbol gene type direction distance location
gja5b LOC106574307 coding upstream 111207 24573406 ~ 24583614 (+)
LOC110527543 LOC106575235 coding upstream 319069 24358668 ~ 24426341 (+)
LOC110527542 LOC106574301 coding upstream 342820 24309838 ~ 24352001 (+)
LOC110527540 LOC106533352 coding upstream 1073770 23609520 ~ 23621369 (+)
LOC110527538 LOC106575225 coding upstream 1377351 23306816 ~ 23317470 (+)
setd4 setd4 coding downstream 519 24723626 ~ 24732898 (+)
itsn1 LOC100286499 coding downstream 15090 24738197 ~ 24800444 (+)
LOC110527557 pknx1 coding downstream 88268 24811375 ~ 24820304 (+)
pdxkb LOC106574311 coding downstream 114177 24837284 ~ 24870911 (+)
LOC110527559 plcc coding downstream 149314 24872421 ~ 24902570 (+)
G588665 NA non-coding upstream 946 24693590 ~ 24693875 (+)
G588664 NA non-coding upstream 3255 24691356 ~ 24691566 (+)
G588660 NA non-coding upstream 8459 24686132 ~ 24686362 (+)
G588580 NA non-coding upstream 139774 24554798 ~ 24555047 (+)
G588575 NA non-coding upstream 144959 24547453 ~ 24549862 (+)
G588687 NA non-coding downstream 77477 24800584 ~ 24802867 (+)
G588716 NA non-coding downstream 106981 24830088 ~ 24830298 (+)
G588717 NA non-coding downstream 109648 24832755 ~ 24833011 (+)
G588720 NA non-coding downstream 112491 24835598 ~ 24835868 (+)
G588764 NA non-coding downstream 199170 24922277 ~ 24922579 (+)
G587660 NA other upstream 886821 23807722 ~ 23808000 (+)
G586685 NA other upstream 1679701 23010061 ~ 23015120 (+)
LOC110527523 stat1-2 other upstream 1991000 22684527 ~ 22722539 (+)
c7h10orf53 cssa17h10orf53 other upstream 2334594 22356500 ~ 22360232 (+)
G588755 NA other downstream 181224 24904331 ~ 24905581 (+)
G589734 NA other downstream 880498 25587088 ~ 25608606 (+)
G589933 NA other downstream 1280823 26003930 ~ 26025309 (+)
G590936 gart other downstream 1829447 26552554 ~ 26553542 (+)
G590949 LOC106575121 other downstream 1854300 26577407 ~ 26577933 (+)

Expression


Co-expression Network