G590620



Basic Information


Item Value
gene id G590620
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 26301191 ~ 26301503 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU673489
GTCAGGCCATATACTCCAAATGTCATGCCATATACTCCAAATGTCAGGCCATATACTCCAAATGTCAGGCCATATACTCCAAATGTCAGGCCATATACTCCAAATGTCAGGCCATATACTCCAAATGTCAAGCCATATACTCCAAATGTCATGCCATATACTGAAAACGTCAGGCCATATACTCCAAATGTCAGGCCATATACTCCAAATGTCATGCCATATACTCCAAATGTCAGGCCATATACTCCAAATGTCAGGCCATATACTCCAC

Function


NR:

description
PREDICTED: cadherin-like and PC-esterase domain-containing protein 1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU673489 True 271 lncRNA 0.42 2 26301191 26301503

Neighbor


gene id symbol gene type direction distance location
LOC110527587 LOC106575119 coding downstream 161242 26096153 ~ 26139949 (-)
LOC110527586 LOC106574337 coding downstream 215561 26060369 ~ 26085630 (-)
adamts1 adamts1 coding downstream 245744 26047765 ~ 26086045 (-)
cyyr1 cyyr1 coding downstream 255733 26035647 ~ 26045458 (-)
appa app coding downstream 275875 25983669 ~ 26025316 (-)
gart gart coding upstream 246166 26547669 ~ 26571079 (-)
LOC110527590 LOC106575121 coding upstream 274469 26575613 ~ 26585525 (-)
LOC110527591 LOC106575122 coding upstream 428135 26729638 ~ 27142641 (-)
fam155a fam155a coding upstream 1320203 27621706 ~ 27691752 (-)
LOC110527595 lig4 coding upstream 1401950 27703453 ~ 27707840 (-)
G590597 NA non-coding downstream 22377 26278577 ~ 26278814 (-)
G590584 NA non-coding downstream 30322 26270333 ~ 26270869 (-)
G590539 NA non-coding downstream 64332 26236659 ~ 26236859 (-)
G590430 NA non-coding downstream 154677 26146162 ~ 26146514 (-)
G590397 NA non-coding downstream 205788 26094958 ~ 26095403 (-)
G590623 NA non-coding upstream 2744 26304247 ~ 26304717 (-)
G590701 NA non-coding upstream 48624 26350127 ~ 26350596 (-)
G590865 NA non-coding upstream 170068 26471571 ~ 26471772 (-)
G591304 NA non-coding upstream 216960 26518463 ~ 26518756 (-)
G591305 NA non-coding upstream 217806 26519309 ~ 26519526 (-)
G590443 NA other downstream 142886 26157993 ~ 26158305 (-)
G589705 NA other downstream 755773 25544735 ~ 25545418 (-)
LOC110527565 LOC106575142 other downstream 1010586 25215219 ~ 25290844 (-)
G589529 NA other downstream 1022317 25201406 ~ 25278874 (-)
G589093 NA other downstream 1322084 24971613 ~ 24979107 (-)
G591808 NA other upstream 864672 27166175 ~ 27166468 (-)
G592298 NA other upstream 1181454 27482957 ~ 27483780 (-)
G594636 LOC106593246 other upstream 2722904 29024407 ~ 29026049 (-)
G594762 NA other upstream 3115352 29416855 ~ 29495130 (-)

Expression



Co-expression Network