G591403



Basic Information


Item Value
gene id G591403
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 26682281 ~ 26682605 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU674306
actttcagtgctgcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaaatttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagtgataatattgaaatggaaggagtatcagacc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU674306 True 325 lncRNA 0.42 1 26682281 26682605
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110527590 LOC106575121 coding downstream 96756 26575613 ~ 26585525 (-)
gart gart coding downstream 111202 26547669 ~ 26571079 (-)
LOC110527587 LOC106575119 coding downstream 542332 26096153 ~ 26139949 (-)
LOC110527586 LOC106574337 coding downstream 596651 26060369 ~ 26085630 (-)
adamts1 adamts1 coding downstream 626834 26047765 ~ 26086045 (-)
LOC110527591 LOC106575122 coding upstream 47033 26729638 ~ 27142641 (-)
fam155a fam155a coding upstream 939101 27621706 ~ 27691752 (-)
LOC110527595 lig4 coding upstream 1020848 27703453 ~ 27707840 (-)
irs2a irs2 coding upstream 1061358 27741604 ~ 27765935 (-)
LOC110527597 rab20 coding upstream 1099332 27781937 ~ 27785215 (-)
G591349 NA non-coding downstream 84184 26597833 ~ 26598097 (-)
G591348 NA non-coding downstream 85005 26597014 ~ 26597276 (-)
G591291 NA non-coding downstream 118970 26562791 ~ 26563311 (-)
G591323 NA non-coding downstream 138025 26543995 ~ 26544256 (-)
G591413 NA non-coding upstream 18086 26700691 ~ 26700913 (-)
G591414 NA non-coding upstream 20909 26703514 ~ 26703748 (-)
G591443 NA non-coding upstream 83266 26765871 ~ 26770809 (-)
G591583 NA non-coding upstream 285572 26968177 ~ 27007229 (-)
G591715 NA non-coding upstream 464632 27147237 ~ 27147476 (-)
G590443 NA other downstream 523976 26157993 ~ 26158305 (-)
G589705 NA other downstream 1136863 25544735 ~ 25545418 (-)
LOC110527565 LOC106575142 other downstream 1391676 25215219 ~ 25290844 (-)
G589529 NA other downstream 1403407 25201406 ~ 25278874 (-)
G591808 NA other upstream 483570 27166175 ~ 27166468 (-)
G592298 NA other upstream 800352 27482957 ~ 27483780 (-)
G594636 LOC106593246 other upstream 2341802 29024407 ~ 29026049 (-)
G594762 NA other upstream 2734250 29416855 ~ 29495130 (-)
G594900 NA other upstream 2885596 29568201 ~ 29593462 (-)

Expression


G591403 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G591403 Expression in each Bioproject

Bar chart with 17 bars.
G591403 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network