G595820



Basic Information


Item Value
gene id G595820
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 30462669 ~ 30492735 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU679056
aacaaacatagactgcccacccaactcacgccctgaccatactaaataaatacaaaaacaaaggaaatagaggtcagaacgtgacagtcatagttgaagtgtacctataatgaaaattacaggcctctctcatctttttaagtgggagaacttgcacaattggtggctgactaaatacttttttgccccactgtatgtaaataatgtatttctgttttatttgtaataaatttgcaaacatttctaaaatctgtttttgccttctcattatgggggattgtgtgtagatagatgaggaacatgttttatttaatacattttagaataaagc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU679056 True 331 lncRNA 0.34 2 30462669 30492735
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110527641 LOC106582623 coding downstream 67878 30311282 ~ 30394791 (-)
LOC110527624 LOC106595982 coding downstream 335850 30121975 ~ 30126819 (-)
LOC110527614 NA coding downstream 342820 30114634 ~ 30119849 (-)
LOC118965350 LOC106593417 coding downstream 434467 30026703 ~ 30028202 (-)
trnaw-cca-2 NA coding downstream 571949 29890649 ~ 29890720 (-)
LOC110527645 NA coding upstream 92768 30585503 ~ 30593851 (-)
LOC110527646 asip coding upstream 111362 30604097 ~ 30611268 (-)
LOC110528941 LOC103372673 coding upstream 156254 30648989 ~ 30686105 (-)
LOC118965351 NA coding upstream 405192 30897927 ~ 30912147 (-)
LOC110527649 myc coding upstream 456742 30949477 ~ 30953659 (-)
G595798 LOC106583515 non-coding downstream 21214 30441077 ~ 30441455 (-)
G595796 NA non-coding downstream 22971 30439468 ~ 30439698 (-)
G595792 NA non-coding downstream 27392 30435061 ~ 30435277 (-)
G595778 NA non-coding downstream 42038 30420349 ~ 30420631 (-)
G595486 NA non-coding downstream 104148 30358291 ~ 30358521 (-)
G595841 NA non-coding upstream 2261 30494996 ~ 30495223 (-)
G595876 NA non-coding upstream 46131 30538866 ~ 30539591 (-)
G595879 NA non-coding upstream 50062 30542797 ~ 30543015 (-)
G595853 LOC104945811 non-coding upstream 83382 30576117 ~ 30578870 (-)
G595887 NA non-coding upstream 86973 30579708 ~ 30579919 (-)
G595364 NA other downstream 151735 30310171 ~ 30310934 (-)
G595022 NA other downstream 633104 29827953 ~ 29829565 (-)
G594968 LOC106591690 other downstream 735179 29721676 ~ 29727490 (-)
G594905 NA other downstream 836770 29589993 ~ 29625899 (-)
G596094 NA other upstream 351446 30844181 ~ 30844624 (-)
G596039 NA other upstream 370122 30862857 ~ 30863320 (-)
G596352 NA other upstream 443430 30936165 ~ 30936614 (-)
G596433 NA other upstream 585777 31078512 ~ 31079318 (-)

Expression


G595820 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G595820 Expression in each Bioproject

Bar chart with 16 bars.
G595820 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network