G596039



Basic Information


Item Value
gene id G596039
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 30862857 ~ 30863320 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU679294
aagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcatgtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcttttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaaca

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU679294 True 464 TUCP 0.41 1 30862857 30863320

Neighbor


gene id symbol gene type direction distance location
LOC110528941 LOC103372673 coding downstream 176752 30648989 ~ 30686105 (-)
LOC110527646 asip coding downstream 251638 30604097 ~ 30611268 (-)
LOC110527645 NA coding downstream 269006 30585503 ~ 30593851 (-)
LOC110527641 LOC106582623 coding downstream 468066 30311282 ~ 30394791 (-)
LOC110527624 LOC106595982 coding downstream 736038 30121975 ~ 30126819 (-)
LOC118965351 NA coding upstream 34607 30897927 ~ 30912147 (-)
LOC110527649 myc coding upstream 86157 30949477 ~ 30953659 (-)
LOC110527650 ergi3 coding upstream 126539 30989859 ~ 31005163 (-)
LOC110527651 LOC106582630 coding upstream 163998 31027318 ~ 31037871 (-)
LOC110527652 pigu coding upstream 213567 31076887 ~ 31097917 (-)
G595917 LOC106582627 non-coding downstream 226838 30634500 ~ 30636019 (-)
G595918 NA non-coding downstream 228966 30633374 ~ 30633891 (-)
G595915 NA non-coding downstream 236143 30623484 ~ 30626714 (-)
G595899 NA non-coding downstream 266699 30595053 ~ 30596158 (-)
G595888 NA non-coding downstream 281826 30580817 ~ 30581031 (-)
G596105 NA non-coding upstream 330 30863650 ~ 30863858 (-)
G596115 NA non-coding upstream 4074 30867394 ~ 30867610 (-)
G596145 NA non-coding upstream 22649 30885969 ~ 30886210 (-)
G596146 NA non-coding upstream 23776 30887096 ~ 30887375 (-)
G596153 NA non-coding upstream 30749 30894069 ~ 30894305 (-)
G596094 NA other downstream 18233 30844181 ~ 30844624 (-)
G595364 NA other downstream 551923 30310171 ~ 30310934 (-)
G595022 NA other downstream 1033292 29827953 ~ 29829565 (-)
G594968 LOC106591690 other downstream 1135367 29721676 ~ 29727490 (-)
G596352 NA other upstream 72845 30936165 ~ 30936614 (-)
G596433 NA other upstream 215192 31078512 ~ 31079318 (-)
G598354 NA other upstream 1554870 32418190 ~ 32420148 (-)
G599058 NA other upstream 2374727 33237359 ~ 33239795 (-)
G599788 NA other upstream 2812759 33674546 ~ 33677297 (-)

Expression


G596039 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G596039 Expression in each Bioproject

Bar chart with 19 bars.
G596039 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network