G598355



Basic Information


Item Value
gene id G598355
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 32420321 ~ 32421072 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU681690
tgatgctgccaccaccatgtttgacagtggggatggtgtgttcagggtgatgagctgtgttgcttttaagccaaacataatgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacgacactttttatggatatctttaagaaatggctttcttcttgccactcttctataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgagagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtatccagatccggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctcatgacgcttttaacggacctctgagactatcacagtgcaggtgcagttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagta
>TU681691
tttcttcttgccactcttctataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgagagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtatccagatccggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctcatgacgcttttaacggacctctgagactatcacagtgcaggtgcagttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU681690 False 752 lncRNA 0.44 1 32420321 32421072
TU681691 True 534 lncRNA 0.44 1 32420321 32420854

Neighbor


gene id symbol gene type direction distance location
psmf1 psmf1 coding downstream 97163 32305811 ~ 32323158 (-)
LOC110527655 tmem74b coding downstream 127070 32288164 ~ 32293251 (-)
bc10 bc10 coding downstream 153676 32261170 ~ 32266645 (-)
LOC110527654 LOC106582632 coding downstream 245785 32075882 ~ 32174536 (-)
LOC110527652 pigu coding downstream 1322404 31076887 ~ 31097917 (-)
si:ch211-15p9.2 LOC106582638 coding upstream 592 32421664 ~ 32424650 (-)
LOC118965410 NA coding upstream 122886 32543958 ~ 32544012 (-)
LOC110527664 LOC106582643 coding upstream 371108 32792180 ~ 32822397 (-)
LOC110527666 if6 coding upstream 477274 32898346 ~ 32913140 (-)
fam83c fam83c coding upstream 520834 32941906 ~ 32950746 (-)
G598356 NA non-coding downstream 4035 32415767 ~ 32416286 (-)
G598304 NA non-coding downstream 87289 32319013 ~ 32333032 (-)
G597665 NA non-coding downstream 378245 32041868 ~ 32042076 (-)
G597649 NA non-coding downstream 385642 32034417 ~ 32034679 (-)
G598394 NA non-coding upstream 12533 32433605 ~ 32433947 (-)
G598398 NA non-coding upstream 17547 32438619 ~ 32438825 (-)
G598409 NA non-coding upstream 30827 32451899 ~ 32452191 (-)
G598411 NA non-coding upstream 33417 32454489 ~ 32454706 (-)
G598418 NA non-coding upstream 42067 32463139 ~ 32463377 (-)
G598354 NA other downstream 173 32418190 ~ 32420148 (-)
G596433 NA other downstream 1341003 31078512 ~ 31079318 (-)
G596352 NA other downstream 1483707 30936165 ~ 30936614 (-)
G596039 NA other downstream 1557001 30862857 ~ 30863320 (-)
G596094 NA other downstream 1575697 30844181 ~ 30844624 (-)
G599058 NA other upstream 816975 33237359 ~ 33239795 (-)
G599788 NA other upstream 1255007 33674546 ~ 33677297 (-)
LOC110527679 LOC106565035 other upstream 1348978 33770050 ~ 33774908 (-)
G600721 NA other upstream 2193420 34614492 ~ 34614875 (-)
G600872 NA other upstream 2544375 34965447 ~ 34966786 (-)

Expression


G598355 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G598355 Expression in each Bioproject

Bar chart with 20 bars.
G598355 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network