G599634



Basic Information


Item Value
gene id G599634
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 33382811 ~ 33383239 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU683050
gtattcgtcaatgttgttgtctgacgcaatacgaaacatgtcccagtccacgtgatggaagcagtcttggagtgtggagtcagcttggtcggaccagcgttgaacagacctcagcgtgggagcctcttgttttagtttctgtctgtaggcagggatcaacaaaatggagtcgtggtcagcttttccgaaaggggggcggggcagggccttatatgcgtcgcggaagttagagtaacaatgatccaaggtctttccacccctggttgcgcaatcgatatgctgataaaatttagggagtcttgttttcagattagccttgttaaaatccccagctacaatgaatgcagcctccggataaatggtttccagtttgcaaagagtcaaataaagttcattcagagccatcgatgtgtctgcttgggggggggg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU683050 True 429 lncRNA 0.49 1 33382811 33383239

Neighbor


gene id symbol gene type direction distance location
oser1 oser1 coding downstream 20567 33332996 ~ 33362244 (-)
LOC118965284 NA coding downstream 40220 33340670 ~ 33342591 (-)
gdf5 gdf5 coding downstream 232986 33146428 ~ 33149825 (-)
LOC110527668 LOC106582647 coding downstream 383938 32959859 ~ 32998873 (-)
fam83c fam83c coding downstream 432065 32941906 ~ 32950746 (-)
LOC118965409 NA coding upstream 117968 33501207 ~ 33501261 (-)
LOC110527676 stk4 coding upstream 294105 33677344 ~ 33746700 (-)
LOC110527679 LOC106565035 coding upstream 386832 33770050 ~ 33774908 (-)
ywhaba LOC100136192 coding upstream 433984 33817223 ~ 33835858 (-)
abraa LOC106582659 coding upstream 568736 33951832 ~ 33958325 (-)
G599614 NA non-coding downstream 20169 33362291 ~ 33362642 (-)
G599583 NA non-coding downstream 87121 33290317 ~ 33295690 (-)
G599092 NA non-coding downstream 128223 33254381 ~ 33254588 (-)
G599090 NA non-coding downstream 128907 33253692 ~ 33253904 (-)
G599072 NA non-coding downstream 140938 33241646 ~ 33241873 (-)
G599635 NA non-coding upstream 592 33383831 ~ 33384133 (-)
G599643 NA non-coding upstream 10129 33393368 ~ 33416307 (-)
G599699 NA non-coding upstream 108431 33491670 ~ 33551343 (-)
G599795 NA non-coding upstream 224825 33608064 ~ 33608285 (-)
G599839 NA non-coding upstream 280846 33664085 ~ 33664294 (-)
G599058 NA other downstream 143016 33237359 ~ 33239795 (-)
G598354 NA other downstream 962663 32418190 ~ 32420148 (-)
G596433 NA other downstream 2303493 31078512 ~ 31079318 (-)
G596352 NA other downstream 2446197 30936165 ~ 30936614 (-)
G596039 NA other downstream 2519491 30862857 ~ 30863320 (-)
G599788 NA other upstream 292840 33674546 ~ 33677297 (-)
G600721 NA other upstream 1231253 34614492 ~ 34614875 (-)
G600872 NA other upstream 1582208 34965447 ~ 34966786 (-)
G600881 NA other upstream 1618641 35001880 ~ 35055228 (-)

Expression


G599634 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G599634 Expression in each Bioproject

Bar chart with 18 bars.
G599634 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network