G600421



Basic Information


Item Value
gene id G600421
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 34741387 ~ 34741651 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU683941
ctcactgaccctctctccctcctctactccctgaccctctctctcccctctctactccctgaccctctctctcccctctctactcactgaccctctctcccctctctactcactgaccatcactctcccctctctattcactgaccctctctcccctttctactcactgaccctctctccctcctctactccctgaccctctctctcccctctctactcactgaccctctctctcccctctctactctctgaccctctctctccc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU683941 True 265 lncRNA 0.58 1 34741387 34741651

Neighbor


gene id symbol gene type direction distance location
LOC118965286 NA coding upstream 12577 34726401 ~ 34728810 (+)
rims4 rims4 coding upstream 796819 33884249 ~ 33944568 (+)
tomm34 LOC106582656 coding upstream 933908 33801778 ~ 33807479 (+)
LOC118965285 NA coding upstream 941659 33774881 ~ 33799728 (+)
si:dkey-43k4.5 LOC106582653 coding upstream 1086841 33650637 ~ 33654546 (+)
LOC118965354 NA coding downstream 1264760 36006411 ~ 36024368 (+)
LOC110527683 LOC106582660 coding downstream 1728665 36470316 ~ 36536037 (+)
LOC110527684 NA coding downstream 1769343 36510994 ~ 36517194 (+)
LOC110527686 LOC106582662 coding downstream 1832160 36573811 ~ 36582978 (+)
LOC110527688 LOC106582663 coding downstream 1927150 36668801 ~ 36679505 (+)
G600419 NA non-coding upstream 2642 34738386 ~ 34738745 (+)
G600418 NA non-coding upstream 4611 34736359 ~ 34736776 (+)
G600417 NA non-coding upstream 5507 34734285 ~ 34735880 (+)
G600407 NA non-coding upstream 27822 34713338 ~ 34713565 (+)
G600399 NA non-coding upstream 45275 34695274 ~ 34696112 (+)
G600429 NA non-coding downstream 14269 34755920 ~ 34756129 (+)
G600435 NA non-coding downstream 24702 34766353 ~ 34766645 (+)
G600437 NA non-coding downstream 38876 34780527 ~ 34780804 (+)
G600442 NA non-coding downstream 42987 34784638 ~ 34784955 (+)
G600445 NA non-coding downstream 49139 34790790 ~ 34791271 (+)
G600013 NA other upstream 774632 33966289 ~ 33966755 (+)
G599123 NA other upstream 1445859 33290526 ~ 33295528 (+)
G599004 NA other upstream 1504751 33235813 ~ 33236636 (+)
LOC110531742 LOC106594194 other upstream 2731457 32007023 ~ 32013203 (+)
G596297 NA other upstream 3659097 31081721 ~ 31082290 (+)
G600431 NA other downstream 17696 34759347 ~ 34759658 (+)
G600531 NA other downstream 229477 34971128 ~ 34971405 (+)
G602295 gli1 other downstream 2347973 37089624 ~ 37090756 (+)
G604207 NA other downstream 3757380 38499031 ~ 38499662 (+)

Expression


G600421 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G600421 Expression in each Bioproject

Bar chart with 7 bars.
G600421 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network