XLOC_025406


Basic Information

Item Value
gene id XLOC_025406
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 28899129 ~ 28926075 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00052345
cgtgtgcatttgaatccatctcgcgatattgtatcacttcaggtacgcgcctactgattcgttgattcaaacgagttgtgaatcaagaagcctctaaagatccgaatcaaactgcagcagcacgccacgaggttttgctcagacttttgggacgtttggaattgctccgtcttgtcaccatgtaacacatagcagcaagacccatgggatttcatcagccactcaccatcagagtcctcagtggaagctgagaagagcagaagaggaagccaagcaagagatgccagaaaaaaagggggaaggaaataatgtgttattttgctgtttgagtataggcaggcgcagtgggtagcacaatcgcctcacagcaagaaggtcgctggttcgagcctcggctgggtcagttgacatttctgtggcatttgtgcatgttctccccatgttagcatgggtttcctccgggtgctcccacaagtccaaaaatatgtggtgacattgggtaaggtaaaattgtccgtagtgtatgtgtgtgaatgagtatgtatggatgtttcccagtgatgggttgcagctgggtggcaacacggtggcacagtaggtagtgctgtttcctcacatcaagaaggtttctgcatggagttctccctgcgttcgcgtgggtttcctccgggtgctccggtttccctcacagtccaaagacatgcggtacaggtgaattgggtagactaaattgtccgtagtgaatgcgtgtgagtgagtgtgtatggatgtttcccagagatgggttgcagctggaagggcatccactgcgtaaaacatatgctggataagatggtggtttattccactgtggcgaccccagattaacaaagccaaagagaaaatgaatgagtataggcaatgatagacaagacaatg

Function

GO:

id name namespace
GO:0001704 formation of primary germ layer biological_process
GO:0001706 endoderm formation biological_process
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0001711 endodermal cell fate commitment biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0001714 endodermal cell fate specification biological_process
GO:0016070 RNA metabolic process biological_process
GO:0007492 endoderm development biological_process
GO:0007498 mesoderm development biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0048785 hatching gland development biological_process
GO:0000079 regulation of cyclin-dependent protein serine/threonine kinase activity biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0045165 cell fate commitment biological_process
GO:0009887 animal organ morphogenesis biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0035050 embryonic heart tube development biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0048568 embryonic organ development biological_process
GO:1904029 regulation of cyclin-dependent protein kinase activity biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0007369 gastrulation biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0003002 regionalization biological_process
GO:0007389 pattern specification process biological_process
GO:0050789 regulation of biological process biological_process
GO:0060795 cell fate commitment involved in formation of primary germ layer biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0001932 regulation of protein phosphorylation biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:0035987 endodermal cell differentiation biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0009790 embryo development biological_process
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0019887 protein kinase regulator activity molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00052345 True 918 lncRNA 0.48 2 28899129 28926075

Neighbor

gene id symbol gene type direction distance location
XLOC_025405 alg1 coding upstream 29489 28860283 ~ 28869640 (+)
XLOC_025404 flr coding upstream 45194 28831450 ~ 28853935 (+)
XLOC_025403 NA coding upstream 115372 28765693 ~ 28783757 (+)
XLOC_025402 NA coding upstream 165364 28649947 ~ 28733765 (+)
XLOC_025401 sept12 coding upstream 271682 28502419 ~ 28627447 (+)
XLOC_025407 lgals1l1 coding downstream 13684 28939759 ~ 28946756 (+)
XLOC_025408 lgals2a coding downstream 27199 28953274 ~ 28961518 (+)
XLOC_025409 cacna1ia coding downstream 156192 29082267 ~ 29378430 (+)
XLOC_025410 BX005369.1 coding downstream 240945 29167020 ~ 29167147 (+)
XLOC_025411 NA coding downstream 467390 29393465 ~ 29398151 (+)
XLOC_025429 BX649540.1 misc downstream 1322664 30248739 ~ 30249036 (+)
XLOC_025393 NA non-coding upstream 1297656 27594373 ~ 27601473 (+)
XLOC_025391 NA non-coding upstream 1404324 27346839 ~ 27494805 (+)
XLOC_025412 BX649558.1 non-coding downstream 479938 29406013 ~ 29409959 (+)
XLOC_025417 NA non-coding downstream 713909 29639984 ~ 29640294 (+)
XLOC_025419 CT573429.1 non-coding downstream 738282 29664357 ~ 29671653 (+)
XLOC_025392 BX000529.1 non-coding upstream 1491918 27407096 ~ 27407211 (+)

Expression


Co-expression Network