G615347 (LOC106582875)



Basic Information


Item Value
gene id G615347
gene name LOC106582875
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 47407726 ~ 47408133 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU700299
TTTCGTCGTATCCTGCCGCCTTGTACTTTTCGTAGAGTTCTGCCTCACTATCGTAGTCATCTGAATATCGTCTTTGCCGGTGGTAGGAATTATCCCTCCTTTCACGCAAATTAAACTCTTCATCCTTCACACGCAACATTTTCCTGGCTCGGACATCACACTGCCTAAATCGACACTTCTGTCTTATTTTGTTGGGACCACCAAATTTCTTCATATCCTTGCAGAAGTCGCATGTGGCACAGTCCTCAGTCCTCAAGCAGGGCTCGCACTCCCCACACATACGA

Function


NR:

description
CXXC-type zinc finger protein 1-like isoform X4

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU700299 True 284 lncRNA 0.47 2 47407726 47408133

Neighbor


gene id symbol gene type direction distance location
LOC110527889 LOC100380687 coding upstream 105631 47296738 ~ 47302095 (+)
sema3fb LOC106582865 coding upstream 378177 46936288 ~ 47029549 (+)
bhlhe40 LOC106582864 coding upstream 597264 46806447 ~ 46810462 (+)
itpr1b LOC106582863 coding upstream 606955 46660325 ~ 46800771 (+)
LOC118965406 NA coding upstream 773460 46634214 ~ 46634266 (+)
LOC110527899 LOC106582878 coding downstream 102867 47511000 ~ 47524578 (+)
LOC110527900 LOC106582882 coding downstream 121252 47529385 ~ 47535288 (+)
LOC110527907 LOC106582887 coding downstream 155931 47564064 ~ 47566159 (+)
si:ch211-232b12.5 LOC106582889 coding downstream 213338 47621471 ~ 47639848 (+)
LOC110527910 LOC106582895 coding downstream 303397 47711530 ~ 47715289 (+)
G615354 LOC106582875 non-coding upstream 434 47406768 ~ 47407292 (+)
G615357 LOC106582875 non-coding upstream 1113 47405921 ~ 47406613 (+)
G615292 NA non-coding upstream 112726 47294546 ~ 47295000 (+)
G615247 NA non-coding upstream 122973 47284506 ~ 47284753 (+)
G615346 LOC106582876 non-coding downstream 24910 47433043 ~ 47484418 (+)
G615345 NA non-coding downstream 70675 47478808 ~ 47482671 (+)
G615439 NA non-coding downstream 129730 47537863 ~ 47538205 (+)
G615444 NA non-coding downstream 134099 47542232 ~ 47542487 (+)
G615340 NA non-coding downstream 136467 47544600 ~ 47544904 (+)
LOC110528958 NA other upstream 769772 46629591 ~ 46638492 (+)
G613664 NA other upstream 1128393 46278734 ~ 46279333 (+)
si:dkey-264d12.5 LOC106582817 other upstream 3379498 44002556 ~ 44035143 (+)
G610622 NA other upstream 3575846 43829004 ~ 43831880 (+)
G610563 LOC106582806 other upstream 3822830 43584020 ~ 43584896 (+)
G615624 NA other downstream 431255 47839388 ~ 47839722 (+)
G617133 NA other downstream 1418694 48826827 ~ 48827227 (+)
tafa4b LOC106583040 other downstream 2164187 49571790 ~ 49620194 (+)
G618712 LOC106583033 other downstream 2895297 50303430 ~ 50304232 (+)
LOC110527970 LOC106583026 other downstream 3552361 50960494 ~ 51079129 (+)

Expression


G615347(LOC106582875) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G615347(LOC106582875) Expression in each Bioproject

Bar chart with 7 bars.
G615347(LOC106582875) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network