G616579



Basic Information


Item Value
gene id G616579
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 48409309 ~ 48409526 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU701659
attcagagggtgaatgggcaagacaaaagatttaagtgcctttgaacgcggtatggtagtaggtgtcaggcgcaccagtttgtgtgtcaagaactgcaacgctgttgttgttttttcacgctcaacagtttcccatgtgtatcaagaatggtccaccacctaaaggacatccagccaacttgacacaactgtgggaagcattggagtcaacaatggcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU701659 True 218 lncRNA 0.47 1 48409309 48409526
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110527924 kcnkf coding upstream 127132 48277681 ~ 48282177 (+)
LOC110510677 LOC100136421 coding upstream 194763 48196782 ~ 48214546 (+)
LOC110527921 LOC106582906 coding upstream 241105 48127960 ~ 48168204 (+)
LOC110527919 LOC106565791 coding upstream 341113 48066923 ~ 48068196 (+)
LOC118965382 NA coding upstream 387134 48021489 ~ 48022175 (+)
LOC110527925 LOC106582912 coding downstream 61161 48470687 ~ 48714043 (+)
lsm14b LOC106582791 coding downstream 327745 48737271 ~ 48740708 (+)
LOC110527931 LOC106582916 coding downstream 425668 48835194 ~ 48845739 (+)
LOC110527932 LOC106582918 coding downstream 452299 48861825 ~ 48874455 (+)
cidec cidec coding downstream 475683 48885209 ~ 48896546 (+)
G616560 NA non-coding upstream 8804 48400241 ~ 48400505 (+)
G616550 NA non-coding upstream 13586 48395491 ~ 48395723 (+)
G616545 NA non-coding upstream 18185 48390897 ~ 48391124 (+)
G616533 NA non-coding upstream 27951 48381122 ~ 48381358 (+)
G615875 NA non-coding upstream 188933 48219727 ~ 48220376 (+)
G616603 NA non-coding downstream 14737 48424263 ~ 48424727 (+)
G616607 NA non-coding downstream 17338 48426864 ~ 48427068 (+)
G616643 NA non-coding downstream 55179 48464705 ~ 48464938 (+)
G616660 NA non-coding downstream 59424 48468950 ~ 48469354 (+)
G616719 NA non-coding downstream 130387 48539913 ~ 48587831 (+)
G615624 NA other upstream 569587 47839388 ~ 47839722 (+)
LOC110528958 NA other upstream 1771355 46629591 ~ 46638492 (+)
G613664 NA other upstream 2129976 46278734 ~ 46279333 (+)
si:dkey-264d12.5 LOC106582817 other upstream 4381081 44002556 ~ 44035143 (+)
G610622 NA other upstream 4577429 43829004 ~ 43831880 (+)
G617133 NA other downstream 417301 48826827 ~ 48827227 (+)
tafa4b LOC106583040 other downstream 1162794 49571790 ~ 49620194 (+)
G618712 LOC106583033 other downstream 1893904 50303430 ~ 50304232 (+)
LOC110527970 LOC106583026 other downstream 2550968 50960494 ~ 51079129 (+)
G621650 NA other downstream 3981822 52391348 ~ 52391633 (+)

Expression


G616579 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G616579 Expression in each Bioproject

Bar chart with 18 bars.
G616579 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network