G616604



Basic Information


Item Value
gene id G616604
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 48424057 ~ 48424287 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU701684
ggccagggtgtggcatgggtttttgtatgtggtgtgttgggtttgtagcttagtggggtgttctagtgaagtctatggctgtctgaagtggttctcaatcagaggcaggtgtttatcgttgtctctgattgggaaccatatttaggcagccatattctttgggtgtttcgtgggtgattgtccttagtgtcctgatgtccttgttctgtgttagtttacacaagtataggc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU701684 True 231 lncRNA 0.46 1 48424057 48424287
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110527922 LOC106582908 coding downstream 180402 48214927 ~ 48243655 (-)
LOC110527920 LOC106582905 coding downstream 305972 48074448 ~ 48118085 (-)
LOC110527918 LOC106582903 coding downstream 431877 47937396 ~ 47992180 (-)
LOC110527917 LOC106582900 coding downstream 487401 47881573 ~ 47936656 (-)
LOC110527915 LOC106582901 coding downstream 542993 47863997 ~ 47881064 (-)
LOC110527927 NA coding upstream 303082 48727369 ~ 48736334 (-)
LOC110527928 LOC106582913 coding upstream 323209 48747496 ~ 48771720 (-)
LOC100136282 LOC106582915 coding upstream 362774 48787061 ~ 48803078 (-)
LOC110527937 LOC106582921 coding upstream 573477 48997764 ~ 49004836 (-)
LOC110527944 NA coding upstream 659623 49083910 ~ 49088195 (-)
G616565 NA non-coding downstream 21721 48402003 ~ 48402336 (-)
G616564 NA non-coding downstream 22141 48401649 ~ 48401916 (-)
G616551 NA non-coding downstream 29098 48394735 ~ 48394959 (-)
G616543 NA non-coding downstream 33897 48389889 ~ 48390160 (-)
G616619 NA non-coding upstream 14979 48439266 ~ 48439467 (-)
G616652 NA non-coding upstream 37706 48461993 ~ 48462225 (-)
G616659 NA non-coding upstream 44438 48468725 ~ 48468925 (-)
G617037 NA non-coding upstream 288181 48712468 ~ 48714023 (-)
G617038 NA non-coding upstream 290585 48714872 ~ 48715169 (-)
LOC110527888 LOC106582868 other downstream 1153986 47260325 ~ 47284791 (-)
G613411 LOC106582852 other downstream 2548357 45874965 ~ 45875700 (-)
G611674 NA other downstream 3938305 44484855 ~ 44485752 (-)
G610570 LOC106582807 other downstream 4844093 43579093 ~ 43579964 (-)
LOC110527816 LOC106582802 other downstream 4887092 43526691 ~ 43537037 (-)
G616880 NA other upstream 62760 48487047 ~ 48529168 (-)
G617624 LOC106582928 other upstream 760137 49184424 ~ 49186096 (-)
G617632 NA other upstream 771317 49195604 ~ 49195970 (-)
mustn1b mstn1 other upstream 870968 49295040 ~ 49297305 (-)
LOC110527961 LOC106565835 other upstream 1235748 49660022 ~ 49936575 (-)

Expression


G616604 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G616604 Expression in each Bioproject

Bar chart with 20 bars.
G616604 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network