G616603



Basic Information


Item Value
gene id G616603
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 48424263 ~ 48424727 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU701683
caaaaacccatgccacaccctggcctgaccaaataaatgaaaataaacacaaaatacttcgaccagggcgtgacagaataagagaggaccaagtacagagtcttggggcacaccattaaagacagacaatttaacagacatacgtccatcaaattgagtgcactgagttctatcagacagatagttagcaaaccatgcaactgcatgctctgaaagaccaacactcgacaatctctgccttagtatagcatgatcaactgtatcaaaagccttagagagatcaataaaaagtgagacacagtgctgttttttgtcaagggcttcagtgatatcatttaaaatcttcatggctgctgtaattgtgctatgcttcttcctgaagcccaattggtacattgataaaatagagttagtaaataaaaactattttagctgttcactcacaagggtttcaaatattttcac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU701683 True 465 lncRNA 0.39 1 48424263 48424727
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110527924 kcnkf coding upstream 142086 48277681 ~ 48282177 (+)
LOC110510677 LOC100136421 coding upstream 209717 48196782 ~ 48214546 (+)
LOC110527921 LOC106582906 coding upstream 256059 48127960 ~ 48168204 (+)
LOC110527919 LOC106565791 coding upstream 356067 48066923 ~ 48068196 (+)
LOC118965382 NA coding upstream 402088 48021489 ~ 48022175 (+)
LOC110527925 LOC106582912 coding downstream 45960 48470687 ~ 48714043 (+)
lsm14b LOC106582791 coding downstream 312544 48737271 ~ 48740708 (+)
LOC110527931 LOC106582916 coding downstream 410467 48835194 ~ 48845739 (+)
LOC110527932 LOC106582918 coding downstream 437098 48861825 ~ 48874455 (+)
cidec cidec coding downstream 460482 48885209 ~ 48896546 (+)
G616579 NA non-coding upstream 14737 48409309 ~ 48409526 (+)
G616560 NA non-coding upstream 23758 48400241 ~ 48400505 (+)
G616550 NA non-coding upstream 28540 48395491 ~ 48395723 (+)
G616545 NA non-coding upstream 33139 48390897 ~ 48391124 (+)
G616533 NA non-coding upstream 42905 48381122 ~ 48381358 (+)
G616607 NA non-coding downstream 2137 48426864 ~ 48427068 (+)
G616643 NA non-coding downstream 39978 48464705 ~ 48464938 (+)
G616660 NA non-coding downstream 44223 48468950 ~ 48469354 (+)
G616719 NA non-coding downstream 115186 48539913 ~ 48587831 (+)
G616834 NA non-coding downstream 289745 48714472 ~ 48714693 (+)
G615624 NA other upstream 584541 47839388 ~ 47839722 (+)
LOC110528958 NA other upstream 1786309 46629591 ~ 46638492 (+)
G613664 NA other upstream 2144930 46278734 ~ 46279333 (+)
si:dkey-264d12.5 LOC106582817 other upstream 4396035 44002556 ~ 44035143 (+)
G610622 NA other upstream 4592383 43829004 ~ 43831880 (+)
G617133 NA other downstream 402100 48826827 ~ 48827227 (+)
tafa4b LOC106583040 other downstream 1147593 49571790 ~ 49620194 (+)
G618712 LOC106583033 other downstream 1878703 50303430 ~ 50304232 (+)
LOC110527970 LOC106583026 other downstream 2535767 50960494 ~ 51079129 (+)
G621650 NA other downstream 3966621 52391348 ~ 52391633 (+)

Expression


G616603 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G616603 Expression in each Bioproject

Bar chart with 18 bars.
G616603 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network