XLOC_025429 (BX649540.1)


Basic Information

Item Value
gene id XLOC_025429
gene name BX649540.1
gene type misc
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 30248739 ~ 30249036 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00050160
GCCGGGCGCAGTGGCGTGCGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGACCGCTTGAGCTCAGGGGTTCTGGGCTGCAGTGGACTATGCCGATCGGGTGTCCGCACTAAGTTCGGTATCGATATGGTGCTCCTGGGGGAGCCTTGGACTACCAGGTCGTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAGACGGAGCAGGTCAAAGCCCCCGTGCCGATCAGTAGTGGGATCGCGCCTGTGAATAGACACTGCAGTGCAGCCTGAGTAATACAGCGGGACTCAGTCTTT

Function

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000087732

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00050160 True 298 misc_RNA 0.61 1 30248739 30249036
Loading

Neighbor

gene id symbol gene type direction distance location
XLOC_025428 akt1s1 coding upstream 48182 30190419 ~ 30200557 (+)
XLOC_025427 kcna7 coding upstream 264871 29980603 ~ 29983868 (+)
XLOC_025426 NA coding upstream 281669 29966783 ~ 29967070 (+)
XLOC_025425 ifi35 coding upstream 299784 29941777 ~ 29948955 (+)
XLOC_025424 BX901883.3 coding upstream 318852 29929582 ~ 29929887 (+)
XLOC_025430 mybpc2a coding downstream 8546 30257582 ~ 30353255 (+)
XLOC_025431 CR936968.2 coding downstream 105732 30354768 ~ 30355587 (+)
XLOC_025432 NA coding downstream 248685 30497721 ~ 30506149 (+)
XLOC_025433 si:dkey-13n23.3 coding downstream 251932 30500968 ~ 30504419 (+)
XLOC_025434 NA coding downstream 394126 30643162 ~ 30655558 (+)
XLOC_025423 NA non-coding upstream 333382 29914444 ~ 29915357 (+)
XLOC_025420 NA non-coding upstream 538517 29687549 ~ 29710222 (+)
XLOC_025419 CT573429.1 non-coding upstream 577086 29664357 ~ 29671653 (+)
XLOC_025435 NA non-coding downstream 445138 30694174 ~ 30695807 (+)
XLOC_025436 NA non-coding downstream 619382 30868418 ~ 30873160 (+)

Expression

Expression of XLOC_025429(BX649540.1) in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Expression of XLOC_025429(BX649540.1) in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) G80831 NA non-coding CI01000013 null 4571764 ~ 4572100 (+)
bowfin (Amia calva) G150475 NA non-coding CM030141.1 CM030141.1 15228957 ~ 15229262 (+)
mexican tetra (Astyanax mexicanus) G68139 NA non-coding NC_035903.1 CM008306.1 32258341 ~ 32265748 (+)