G623180



Basic Information


Item Value
gene id G623180
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 53753906 ~ 53754119 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU708825
gacacgaagcctccagtgatgatccatggcacgaagcctccagtgatgatccatggcacgaagcctccagtgatgatccatggcaagaagcctccagtgatgatccatggcaagaagcctccagtgatgatccatggcacgaagcctccagtgatgatccatggcaagaagcctccagtgatgatccatgacacgaagcctccagtgatgatct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU708825 True 214 TUCP 0.53 1 53753906 53754119
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110527998 ppb coding upstream 3467 53731955 ~ 53750439 (+)
LOC110527993 cssa22h1orf116 coding upstream 164436 53581935 ~ 53637160 (+)
LOC110527995 yod1 coding upstream 179499 53569509 ~ 53574407 (+)
LOC110527992 pfkfb2 coding upstream 190715 53552308 ~ 53563191 (+)
LOC110527990 LOC106583000 coding upstream 207715 53530233 ~ 53546191 (+)
LOC110527122 LOC106582938 coding downstream 47199 53801318 ~ 53815919 (+)
LOC110528000 LOC106582986 coding downstream 136256 53890375 ~ 54051092 (+)
lrrc38b LOC106582984 coding downstream 322407 54076526 ~ 54100144 (+)
aadacl4 LOC106582981 coding downstream 429103 54183222 ~ 54190652 (+)
LOC110528007 LOC106582974 coding downstream 1299066 55053185 ~ 55074095 (+)
G622831 NA non-coding upstream 10433 53681073 ~ 53743473 (+)
G622799 NA non-coding upstream 128154 53624441 ~ 53625752 (+)
G622706 NA non-coding upstream 226505 53524367 ~ 53527401 (+)
G622669 NA non-coding upstream 339108 53414510 ~ 53414798 (+)
G623183 NA non-coding downstream 1656 53755775 ~ 53756172 (+)
G623191 NA non-coding downstream 7403 53761522 ~ 53761727 (+)
G623196 NA non-coding downstream 9968 53764087 ~ 53764369 (+)
G623197 NA non-coding downstream 10304 53764423 ~ 53765244 (+)
G623217 NA non-coding downstream 29662 53783781 ~ 53787584 (+)
G621695 LOC106582949 other upstream 1260666 52491168 ~ 52493240 (+)
G621650 NA other upstream 1362273 52391348 ~ 52391633 (+)
LOC110527970 LOC106583026 other upstream 2679899 50960494 ~ 51079129 (+)
G618712 LOC106583033 other upstream 3449674 50303430 ~ 50304232 (+)
tafa4b LOC106583040 other upstream 4133738 49571790 ~ 49620194 (+)
G624628 NA other downstream 1069518 54823637 ~ 54824199 (+)
G624962 LOC106582975 other downstream 1293177 55047296 ~ 55052688 (+)
LOC110527126 LOC106582962 other downstream 1453542 55207615 ~ 55208708 (+)
G625038 NA other downstream 1457586 55211705 ~ 55213911 (+)

Expression


G623180 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

G623180 Expression in each Bioproject

Bar chart with 20 bars.
G623180 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4000.
End of interactive chart.

Co-expression Network