G624872



Basic Information


Item Value
gene id G624872
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 54936030 ~ 54936257 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU710578
TCATAAAGCTGATATGTCAAAATAATGCTTGCACTCGTAAAGTGATTTATTTCTTCCACAACCCAACTATCTACAGGTCTGAACTTTGAGAACACCGAATGCTTTGATTGGATATTGAAAATGCATGAACAGTGTTATTTTGTTAAATGCAAGGCATTGTACAGCAACAAACATGATAGTTATTCAAATATTATAGAGAGGAAGACATTTGGGGAAATCTATTTCTGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU710578 True 228 lncRNA 0.34 1 54936030 54936257
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528004 LOC106582978 coding downstream 450817 54202674 ~ 54485213 (-)
LOC110528966 LOC106582980 coding downstream 737818 54194715 ~ 54198212 (-)
LOC110528002 LOC106582983 coding downstream 755626 54166551 ~ 54180404 (-)
LOC110527124 LOC106582988 coding downstream 1100701 53820460 ~ 53835329 (-)
LOC110527121 LOC106582947 coding downstream 1160519 53774355 ~ 53775511 (-)
LOC110528005 LOC106582976 coding upstream 62184 54998441 ~ 55036498 (-)
LOC110528006 LOC106582975 coding upstream 111036 55047293 ~ 55052787 (-)
LOC110528008 atrap coding upstream 143727 55079890 ~ 55101228 (-)
LOC110528010 LOC106582973 coding upstream 170492 55106749 ~ 55132386 (-)
LOC110528009 LOC106582972 coding upstream 196538 55132795 ~ 55158158 (-)
G624871 NA non-coding downstream 96 54935710 ~ 54935934 (-)
G624864 NA non-coding downstream 8918 54926722 ~ 54927112 (-)
G624861 NA non-coding downstream 11376 54924433 ~ 54924654 (-)
G624858 NA non-coding downstream 17836 54917905 ~ 54918194 (-)
G624852 NA non-coding downstream 25145 54910641 ~ 54910885 (-)
G624878 NA non-coding upstream 11224 54947481 ~ 54947716 (-)
G624879 NA non-coding upstream 11986 54948243 ~ 54948464 (-)
G624882 NA non-coding upstream 18293 54954550 ~ 54954839 (-)
G624889 NA non-coding upstream 32409 54968666 ~ 54968871 (-)
G624892 NA non-coding upstream 35469 54971726 ~ 54971982 (-)
G622985 NA other downstream 1613199 53305536 ~ 53322831 (-)
G619733 NA other downstream 3977490 50956271 ~ 50958540 (-)
LOC110527964 LOC106583033 other downstream 4629874 50300364 ~ 50306278 (-)
LOC110527961 LOC106565835 other downstream 4999749 49660022 ~ 49936575 (-)
mustn1b mstn1 other downstream 5638782 49295040 ~ 49297305 (-)
G625426 NA other upstream 136222 55072479 ~ 55075396 (-)
G625472 LOC106582968 other upstream 228235 55164492 ~ 55188756 (-)
LOC110528020 LOC106582955 other upstream 497199 55420466 ~ 55566988 (-)
G627254 NA other upstream 1755066 56691323 ~ 56696091 (-)
G627314 NA other upstream 1898328 56834350 ~ 56835092 (-)

Expression


G624872 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G624872 Expression in each Bioproject

Bar chart with 8 bars.
G624872 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network